test_geo
Testing Bio.Geo on GSE16.txt
GEO Type: SAMPLE
GEO Id: GSM804
Sample_author: Antoine,M,Snijders
Sample_author: Norma,,Nowak
Sample_author: Richard,,Segraves
Sample_author: Stephanie,,Blackwood
Sample_author: Nils,,Brown
Sample_author: Jeffery,,Conroy
Sample_author: Greg,,Hamilton
Sample_author: Anna,K,Hindle
Sample_author: Bing,,Huey
Sample_author: Karen,,Kimura
Sample_author: Sindy,,Law
Sample_author: Ken,,Myambo
Sample_author: Joel,,Palmer
Sample_author: Bauke,,Ylstra
Sample_author: Jingzhu,P,Yue
Sample_author: Joe,W,Gray
Sample_author: Ajay,N,Jain
Sample_author: Daniel,,Pinkel
Sample_author: Donna,G,Albertson
Sample_description: Coriell Cell Repositories cell line GM05296.
Sample_description: Fibroblast cell line derived from a 1 mo
nth old female with multiple congenital malformations, dysmorphic features, intr
auterine growth retardation, heart murmur, cleft palate, equinovarus deformity,
microcephaly, coloboma of right iris, clinodactyly, reduced RBC catalase activit
y, and 1 copy of catalase gene.
Sample_description: Chromosome abnormalities are present.
Sample_description: Karyotype is 46,XX,-11,+der(11)inv ins(1
1;10)(11pter> 11p13::10q21>10q24::11p13>11qter)mat
Sample_organism: Homo sapiens
Sample_platform_id: GPL28
Sample_pubmed_id: 11687795
Sample_series_id: GSE16
Sample_status: Public on Feb 12 2002
Sample_submission_date: Jan 17 2002
Sample_submitter_city: San Francisco,CA,94143,USA
Sample_submitter_department: Comprehensive Cancer Center
Sample_submitter_email: albertson@cc.ucsf.edu
Sample_submitter_institute: University of California San Francisco
Sample_submitter_name: Donna,G,Albertson
Sample_submitter_phone: 415 502-8463
Sample_target_source1: Cell line GM05296
Sample_target_source2: normal male reference genomic DNA
Sample_title: CGH_Albertson_GM05296-001218
Sample_type: dual channel genomic
Column Header Definitions
ID_REF: Unique row identifier, genome position o
rder
LINEAR_RATIO: Mean of replicate Cy3/Cy5 ratios
LOG2STDDEV: Standard deviation of VALUE
NO_REPLICATES: Number of replicate spot measurements
VALUE: aka LOG2RATIO, mean of log base 2 of LIN
EAR_RATIO
0: ID_REF VALUE LINEAR_RATIO LOG2STDDEV NO_REPLICATES
1: 1 1.047765 0.011853 3
2: 2 0
3: 3 0.008824 1.006135 0.00143 3
4: 4 -0.000894 0.99938 0.001454 3
5: 5 0.075875 1.054 0.003077 3
6: 6 0.017303 1.012066 0.005876 2
7: 7 -0.006766 0.995321 0.013881 3
8: 8 0.020755 1.014491 0.005506 3
9: 9 -0.094938 0.936313 0.012662 3
10: 10 -0.054527 0.96291 0.01073 3
11: 11 -0.025057 0.982782 0.003855 3
12: 12 0
13: 13 0.108454 1.078072 0.005196 3
14: 14 0.078633 1.056017 0.009165 3
15: 15 0.098571 1.070712 0.007834 3
16: 16 0.044048 1.031003 0.013651 3
17: 17 0.018039 1.012582 0.005471 3
18: 18 -0.088807 0.9403 0.010571 3
19: 19 0.016349 1.011397 0.007113 3
20: 20 0.030977 1.021704 0.016798 3
Testing Bio.Geo on GSM645.txt
GEO Type: SAMPLE
GEO Id: GSM645
Sample_author: Reinhard,,Hoffmann
Sample_author: Thomas,,Seidl
Sample_author: Ton,,Rolink
Sample_author: Fritz,,Melchers
Sample_description: B220+CD25+sIg- Large Pre BII cells sorte
d out of mouse bone marrow, sort no. 8
Sample_organism: Mus musculus
Sample_platform_id: GPL22
Sample_series_id: GSE13
Sample_status: Public on Dec 17 2001
Sample_submission_date: Nov 27 2001
Sample_submitter_address: Pettenkoferstr. 9a
Sample_submitter_city: Munich,80336,Germany
Sample_submitter_department: Bacteriology
Sample_submitter_email: r_hoffmann@m3401.mpk.med.uni-muenchen.de
Sample_submitter_institute: Max von Pettenkofer Institut
Sample_submitter_name: Reinhard,,Hoffmann
Sample_submitter_phone: +49-89-5160-5424
Sample_target_source: Large Pre-BII cells
Sample_title: Large Pre-BII cells 8b
Sample_type: single channel
Column Header Definitions
ABS_CALL: Whether a probe set is present, marginal
, or absent; see Affymetrix Literature
Experiment Name: Experiment Name
ID_REF: Affymetrix Probe Set Identifier
Log Avg:
MM Excess: Number of probe peirs where MM/PM exceed
s 1/ratio limit (10 by default)
NEGATIVE: number of negative probe pairs
PAIRS: number of probe set specific probe pairs
on the array
PAIRS_IN_AVG: Trimmed probe pair set
PAIRS_USED:
PM Excess: number of probe pairs where PM/MM excee
ds the ratio limit (10 by default)
POS/NEG: Positive/Negative
POSITIVE: number of poisitive probe pairs
POS_FRACTION: Positive/Pairs Used
VALUE: Average Difference Intensity
0: ID_REF Experiment Name POSITIVE NEGATIVE PAIRS PAIRS_USED PAIRS_IN_AVG POS_FRACTION Log Avg PM Excess MM Excess POS/NEG VALUE ABS_CALL
1: IL2_at RHMu8LarB 4 4 19 19 19 0.21 -0.58 0 0 1.0 -78 A
2: IL10_at RHMu8LarB 7 4 20 20 18 0.35 1.87 1 0 1.8 161 A
3: GMCSF_at RHMu8LarB 4 4 20 20 19 0.20 0.39 0 0 1.0 -11 A
4: TNFRII_at RHMu8LarB 2 2 20 20 18 0.10 0.48 0 0 1.0 52 A
5: MIP1-B_at RHMu8LarB 6 4 20 20 19 0.30 0.43 0 0 1.5 373 A
6: IL4_at RHMu8LarB 3 3 20 20 19 0.15 0.29 0 0 1.0 27 A
7: IL12_P40_at RHMu8LarB 3 5 20 20 19 0.15 -0.22 0 0 0.6 -163 A
8: TNFa_at RHMu8LarB 3 4 20 20 20 0.15 -0.57 1 0 0.8 -95 A
9: TCRa_at RHMu8LarB 1 4 20 20 19 0.05 -0.50 0 0 0.3 -186 A
10: AFFX-BioB-5_at RHMu8LarB 0 1 20 20 19 0.00 0.35 0 0 0.0 120 A
11: AFFX-BioB-M_at RHMu8LarB 0 1 20 20 19 0.00 0.02 0 0 0.0 -13 A
12: AFFX-BioB-3_at RHMu8LarB 2 0 20 20 19 0.10 0.38 0 0 Undef 136 A
13: AFFX-BioC-5_at RHMu8LarB 9 0 20 20 20 0.45 1.33 0 0 Undef 606 P
14: AFFX-BioC-3_at RHMu8LarB 2 0 20 20 19 0.10 0.64 0 0 Undef 257 A
15: AFFX-BioDn-5_at RHMu8LarB 8 0 20 20 20 0.40 1.23 0 0 Undef 380 P
16: AFFX-BioDn-3_at RHMu8LarB 16 0 20 20 19 0.80 2.79 0 0 Undef 2764 P
17: AFFX-CreX-5_at RHMu8LarB 19 0 20 20 19 0.95 5.65 0 0 Undef 4391 P
18: AFFX-CreX-3_at RHMu8LarB 19 0 20 20 20 0.95 6.42 2 0 Undef 10787 P
19: AFFX-BioB-5_st RHMu8LarB 5 3 20 20 19 0.25 0.48 0 0 1.7 80 A
20: AFFX-BioB-M_st RHMu8LarB 2 3 20 20 17 0.10 0.16 0 0 0.7 24 A
Testing Bio.Geo on GSM691.txt
GEO Type: SAMPLE
GEO Id: GSM691
Sample_anchor: NlaIII
Sample_author: Jeffrey,,Marks
Sample_author: Gregory,J,Riggins
Sample_author: Robert,L,Strausberg
Sample_description: This library represents a Cancer Genome
Anatomy Project library, which was either produced through CGAP funding, or dona
ted to CGAP.
Sample_description: The Cancer Genome Anatomy Project (CGAP:
http://cgap.nci.nih.gov) is an interdisciplinary program established and admini
stered by the National Cancer Institute (NCI: http://www.nci.nih.gov) to generat
e the information and technological tools needed to decipher the molecular anato
my of the cancer cell.
Sample_description: Library constructed by Riggins laborator
y Tissue supplied by Jeffrey Marks, Ph.D.
Sample_description: Organ: Breast
Sample_description: Tissue_type: normal epithelial organoids
Sample_description: Library treatment: non-normalized
Sample_description: Tissue description: Breast, Isolated nor
mal epithelial organoids. Derived from a reduction mammoplasty.
Sample_description: Tissue supplier: Jeffrey Marks, Ph.D.
Sample_description: Sample type: Bulk
Sample_description: Producer: Riggins Laboratory
Sample_description: Clones generated to date: 768
Sample_description: Sequences generated to date: 572
Sample_organism: Homo sapiens
Sample_platform_id: GPL4
Sample_series_id: GSE14
Sample_status: Public on Nov 28 2001
Sample_submission_date: Nov 28 2001
Sample_submitter_city: Bethesda,MD,20892,USA
Sample_submitter_department: Cancer Genome Anatomy Project
Sample_submitter_email: cgapbs-r@mail.nih.gov
Sample_submitter_institute: National Cancer Institute
Sample_submitter_name: Robert,L,Strausberg
Sample_submitter_phone: 301-496-1550
Sample_submitter_web_link: http://cgap.nci.nih.gov/
Sample_tag_count: 7165
Sample_target_source: Breast, isolated normal epithelial organ
oids
Sample_title: SAGE_Duke_40N
Sample_type: sage
Sample_web_link: http://cgap.nci.nih.gov
Column Header Definitions
COUNT: Absolute tag count
TAG: Ten base SAGE tag, LINK_PRE:"http://www.
ncbi.nlm.nih.gov/SAGE/SAGEtag.cgi?tag
TPM: Tags per million, or (1000000*COUNT)/(To
tal tags)
0: TAG COUNT TPM
1: TTGGGGTTTC 202 28192.6
2: TAGGTTGTCT 129 18004.2
3: GAGGGAGTTT 109 15212.8
4: TGCACGTTTT 92 12840.2
5: CTGGGTTAAT 83 11584.1
6: GTTGTGGTTA 82 11444.5
7: GATCCCAACT 63 8792.74
8: TGCAGTCACT 59 8234.47
9: GGATTTGGCC 58 8094.91
10: GGGCTGGGGT 56 7815.77
11: ATAATTCTTT 44 6140.96
12: CTTCCTTGCC 42 5861.83
13: TTGGTCCTCT 40 5582.69
14: GGCAAGCCCC 36 5024.42
15: AACTAAAAAA 34 4745.29
16: AGGGCTTCCA 34 4745.29
17: AGGCTACGGA 33 4605.72
18: GTGAAACCCC 32 4466.15
19: AACTAACAAA 31 4326.59
20: GAAAAATGGT 30 4187.02
Testing Bio.Geo on GSM700.txt
GEO Type: SAMPLE
GEO Id: GSM700
Sample_anchor: NlaIII
Sample_author: Gregory,J,Riggins
Sample_author: Robert,L,Strausberg
Sample_description: This library represents a Cancer Genome
Anatomy Project library, which was either produced through CGAP funding, or dona
ted to CGAP.
Sample_description: The Cancer Genome Anatomy Project (CGAP:
http://cgap.nci.nih.gov) is an interdisciplinary program established and admini
stered by the National Cancer Institute (NCI: http://www.nci.nih.gov) to generat
e the information and technological tools needed to decipher the molecular anato
my of the cancer cell.
Sample_description: Cell line grown under 1.5% oxygen condit
ions for 24 hours prior to harvesting in zinc option media with 10% RBS and harv
ested at passage 102. Library constructed in the laboratory of G. Riggins, M.D.,
Ph.D. (Duke University).
Sample_description: Organ: brain
Sample_description: Tissue_type: glioblastoma multiforme
Sample_description: Cell_line: H247
Sample_description: Lab host: DH10B
Sample_description: Vector: pZErO-1
Sample_description: Vector type: plasmid
Sample_description: R. Site 1: Sph1
Sample_description: R. Site 2: Sph1
Sample_description: Library treatment: non-normalized
Sample_description: Tissue description: Brain, Duke glioblas
toma multiforme cell line, H247, grown under 1.5% oxygen conditions for 24 hour
s prior to harvesting.
Sample_description: Tissue
Sample_organism: Homo sapiens
Sample_platform_id: GPL4
Sample_series_id: GSE14
Sample_status: Public on Nov 28 2001
Sample_submission_date: Nov 28 2001
Sample_submitter_city: Bethesda,MD,20892,USA
Sample_submitter_department: Cancer Genome Anatomy Project
Sample_submitter_email: cgapbs-r@mail.nih.gov
Sample_submitter_institute: National Cancer Institute
Sample_submitter_name: Robert,L,Strausberg
Sample_submitter_phone: 301-496-1550
Sample_submitter_web_link: http://cgap.nci.nih.gov/
Sample_tag_count: 72031
Sample_target_source: Brain, glioblastoma multiforme, cell-lin
e H247
Sample_title: SAGE_Duke_H247_Hypoxia
Sample_type: sage
Sample_web_link: http://cgap.nci.nih.gov
Column Header Definitions
COUNT: Absolute tag count
TAG: Ten base SAGE tag, LINK_PRE:"http://www.
ncbi.nlm.nih.gov/SAGE/SAGEtag.cgi?tag
TPM: Tags per million, or (1000000*COUNT)/(To
tal tags)
0: TAG COUNT TPM
1: TCCAAATCGA 520 7219.11
2: TACCATCAAT 434 6025.18
3: TTGGGGTTTC 389 5400.45
4: CCCATCGTCC 367 5095.03
5: GTGAAACCCC 365 5067.26
6: GGGGAAATCG 357 4956.2
7: CCTGTAATCC 346 4803.49
8: TGATTTCACT 334 4636.89
9: TGTGTTGAGA 315 4373.12
10: GCCCCCAATA 303 4206.52
11: CTAAGACTTC 279 3873.33
12: GCGACCGTCA 276 3831.68
13: TTGGTCCTCT 276 3831.68
14: CCTAGCTGGA 268 3720.62
15: GATGAGGAGA 251 3484.61
16: ACTTTTTCAA 244 3387.43
17: CCACTGCACT 223 3095.89
18: GTGTGTTTGT 223 3095.89
19: GAAATACAGT 218 3026.47
20: GCTTTATTTG 218 3026.47
Testing Bio.Geo on GSM804.txt
GEO Type: SAMPLE
GEO Id: GSM804
Sample_author: Antoine,M,Snijders
Sample_author: Norma,,Nowak
Sample_author: Richard,,Segraves
Sample_author: Stephanie,,Blackwood
Sample_author: Nils,,Brown
Sample_author: Jeffery,,Conroy
Sample_author: Greg,,Hamilton
Sample_author: Anna,K,Hindle
Sample_author: Bing,,Huey
Sample_author: Karen,,Kimura
Sample_author: Sindy,,Law
Sample_author: Ken,,Myambo
Sample_author: Joel,,Palmer
Sample_author: Bauke,,Ylstra
Sample_author: Jingzhu,P,Yue
Sample_author: Joe,W,Gray
Sample_author: Ajay,N,Jain
Sample_author: Daniel,,Pinkel
Sample_author: Donna,G,Albertson
Sample_description: Coriell Cell Repositories cell line GM05296.
Sample_description: Fibroblast cell line derived from a 1 mo
nth old female with multiple congenital malformations, dysmorphic features, intr
auterine growth retardation, heart murmur, cleft palate, equinovarus deformity,
microcephaly, coloboma of right iris, clinodactyly, reduced RBC catalase activit
y, and 1 copy of catalase gene.
Sample_description: Chromosome abnormalities are present.
Sample_description: Karyotype is 46,XX,-11,+der(11)inv ins(1
1;10)(11pter> 11p13::10q21>10q24::11p13>11qter)mat
Sample_organism: Homo sapiens
Sample_platform_id: GPL28
Sample_pubmed_id: 11687795
Sample_series_id: GSE16
Sample_status: Public on Feb 12 2002
Sample_submission_date: Jan 17 2002
Sample_submitter_city: San Francisco,CA,94143,USA
Sample_submitter_department: Comprehensive Cancer Center
Sample_submitter_email: albertson@cc.ucsf.edu
Sample_submitter_institute: University of California San Francisco
Sample_submitter_name: Donna,G,Albertson
Sample_submitter_phone: 415 502-8463
Sample_target_source1: Cell line GM05296
Sample_target_source2: normal male reference genomic DNA
Sample_title: CGH_Albertson_GM05296-001218
Sample_type: dual channel genomic
Column Header Definitions
ID_REF: Unique row identifier, genome position o
rder
LINEAR_RATIO: Mean of replicate Cy3/Cy5 ratios
LOG2STDDEV: Standard deviation of VALUE
NO_REPLICATES: Number of replicate spot measurements
VALUE: aka LOG2RATIO, mean of log base 2 of LIN
EAR_RATIO
0: ID_REF VALUE LINEAR_RATIO LOG2STDDEV NO_REPLICATES
1: 1 1.047765 0.011853 3
2: 2 0
3: 3 0.008824 1.006135 0.00143 3
4: 4 -0.000894 0.99938 0.001454 3
5: 5 0.075875 1.054 0.003077 3
6: 6 0.017303 1.012066 0.005876 2
7: 7 -0.006766 0.995321 0.013881 3
8: 8 0.020755 1.014491 0.005506 3
9: 9 -0.094938 0.936313 0.012662 3
10: 10 -0.054527 0.96291 0.01073 3
11: 11 -0.025057 0.982782 0.003855 3
12: 12 0
13: 13 0.108454 1.078072 0.005196 3
14: 14 0.078633 1.056017 0.009165 3
15: 15 0.098571 1.070712 0.007834 3
16: 16 0.044048 1.031003 0.013651 3
17: 17 0.018039 1.012582 0.005471 3
18: 18 -0.088807 0.9403 0.010571 3
19: 19 0.016349 1.011397 0.007113 3
20: 20 0.030977 1.021704 0.016798 3
Testing Bio.Geo on soft_ex_affy.txt
GEO Type: SAMPLE
GEO Id: body wall rep1
Sample_characteristics: Wild type, third instar larvae, body wal
l
Sample_data_processing: Affymetrix Microarray Suite version 5.0
Sample_description: Wild type third instar larvae imaginal w
ing discs
Sample_extract_protocol: Approximately 200 wild-type (Berlin stra
in) wandering third-instar larvae were dissected and the wing discs were collect
ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump
tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme
nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted
from the tissue lysate using an RNeasy kit (Qiagen).
Sample_hyb_protocol: standard Affymetrix procedures
Sample_label: biotin
Sample_label_protocol: Approximately 8 µg of total RNA was proc
essed to produce biotinylated cRNA targets.
Sample_molecule: total RNA
Sample_organism: Drosophila melanogaster
Sample_platform_id: GPL72
Sample_scan_protocol: standard Affymetrix procedures
Sample_source_name: body wall
Sample_title: body wall replicate 1
Column Header Definitions
ABS_CALL: the call in an absolute analysis that in
dicates if the transcript was present (P), absent (A), marginal (M), or no call
(NC)
DETECTION P-VALUE: 'detection p-value', p-value that indica
tes the significance level of the detection call
ID_REF:
VALUE: MAS5-calculated Signal intensity
0: ID_REF VALUE ABS_CALL DETECTION P-VALUE
1: 141200_at 36.6 A 0.818657
2: 141201_at 41.5 A 0.703191
3: 141202_at 607.3 P 0.000944
4: 141203_at 1509.1 P 0.000762
5: 141204_at 837.3 P 0.000613
6: 141205_at 363.2 P 0.003815
7: 141206_at 1193.6 P 0.000491
8: 141207_at 346.6 P 0.001165
9: 141208_at 257.8 P 0.006575
10: 141209_at 337.1 P 0.002607
11: 141210_at 48 A 0.150145
12: 141211_at 130.7 P 0.005504
13: 141212_at 1454.3 P 0.000491
14: 141213_at 21.2 A 0.635055
15: 141214_at 2372.6 P 0.000491
16: 141215_at 452.9 P 0.017732
17: 141216_at 504.1 P 0.006575
18: 141217_at 716.9 P 0.004591
19: 141218_at 3248.8 P 0.000491
20: 141219_at 223.5 P 0.007827
GEO Type: SAMPLE
GEO Id: body wall rep2
Sample_characteristics: Wild type, third instar larvae, body wal
l
Sample_data_processing: Affymetrix Microarray Suite version 5.0
Sample_description: Wild type third instar larvae imaginal w
ing discs
Sample_extract_protocol: Approximately 200 wild-type (Berlin stra
in) wandering third-instar larvae were dissected and the wing discs were collect
ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump
tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme
nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted
from the tissue lysate using an RNeasy kit (Qiagen).
Sample_hyb_protocol: standard Affymetrix procedures
Sample_label: biotin
Sample_label_protocol: Approximately 8 µg of total RNA was proc
essed to produce biotinylated cRNA targets.
Sample_molecule: total RNA
Sample_organism: Drosophila melanogaster
Sample_platform_id: GPL72
Sample_scan_protocol: standard Affymetrix procedures
Sample_source_name: body wall
Sample_title: body wall replicate 2
Column Header Definitions
ABS_CALL: the call in an absolute analysis that in
dicates if the transcript was present (P), absent (A), marginal (M), or no call
(NC)
DETECTION P-VALUE: 'detection p-value', p-value that indica
tes the significance level of the detection call
ID_REF:
VALUE: MAS5-calculated Signal intensity
0: ID_REF VALUE ABS_CALL DETECTION P-VALUE
1: 141200_at 70.3 A 0.216313
2: 141201_at 38 A 0.635055
3: 141202_at 831.8 P 0.000613
4: 141203_at 2215.5 P 0.000944
5: 141204_at 965.6 P 0.000491
6: 141205_at 383.2 P 0.001432
7: 141206_at 1195 P 0.000491
8: 141207_at 413.7 P 0.000613
9: 141208_at 447.3 P 0.000762
10: 141209_at 294.4 P 0.004591
11: 141210_at 81.7 M 0.054711
12: 141211_at 84.9 P 0.005504
13: 141212_at 1456.4 P 0.000491
14: 141213_at 37 A 0.122747
15: 141214_at 2022 P 0.000491
16: 141215_at 690.9 P 0.004591
17: 141216_at 525.1 P 0.000762
18: 141217_at 643.5 P 0.000613
19: 141218_at 2570.5 P 0.000491
20: 141219_at 265.9 P 0.005504
GEO Type: SAMPLE
GEO Id: wing/hinge rep1
Sample_characteristics: Wild type, third instar larvae, wing/hin
ge
Sample_data_processing: Affymetrix Microarray Suite version 5.0
Sample_description: Wild type third instar larvae imaginal w
ing discs
Sample_extract_protocol: Approximately 200 wild-type (Berlin stra
in) wandering third-instar larvae were dissected and the wing discs were collect
ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump
tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme
nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted
from the tissue lysate using an RNeasy kit (Qiagen).
Sample_hyb_protocol: standard Affymetrix procedures
Sample_label: biotin
Sample_label_protocol: Approximately 8 µg of total RNA was proc
essed to produce biotinylated cRNA targets.
Sample_molecule: total RNA
Sample_organism: Drosophila melanogaster
Sample_platform_id: GPL72
Sample_scan_protocol: standard Affymetrix procedures
Sample_source_name: wing/hinge
Sample_title: wing/hinge replicate 1
Column Header Definitions
ABS_CALL: the call in an absolute analysis that in
dicates if the transcript was present (P), absent (A), marginal (M), or no call
(NC)
DETECTION P-VALUE: 'detection p-value', p-value that indica
tes the significance level of the detection call
ID_REF:
VALUE: MAS5-calculated Signal intensity
0: ID_REF VALUE ABS_CALL DETECTION P-VALUE
1: 141200_at 20.8 A 0.801637
2: 141201_at 85.8 A 0.48748
3: 141202_at 704.8 P 0.000613
4: 141203_at 1036.6 P 0.000944
5: 141204_at 700.3 P 0.000491
6: 141205_at 462.4 P 0.003159
7: 141206_at 1301.9 P 0.000491
8: 141207_at 454.8 P 0.000944
9: 141208_at 438.6 P 0.000944
10: 141209_at 264.4 P 0.004591
11: 141210_at 65.6 A 0.150145
12: 141211_at 72.2 A 0.070073
13: 141212_at 1200 P 0.000491
14: 141213_at 13.7 A 0.635055
15: 141214_at 1944 P 0.000491
16: 141215_at 465.5 P 0.005504
17: 141216_at 538.9 P 0.002607
18: 141217_at 753.9 P 0.003159
19: 141218_at 2942.6 P 0.000491
20: 141219_at 283.9 P 0.010972
Testing Bio.Geo on soft_ex_dual.txt
GEO Type: SAMPLE
GEO Id: HS-5 cells rep 1
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5
Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.
Sample_data_processing: After background correction and removal
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.
Sample_description: Human bone marrow stromal cells, HS-5 ce
lls
Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.
Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH,
Tris was removed from the reaction with a Microcon-30 concentrator.
Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.
Sample_label_ch1: Cy5
Sample_label_ch2: Cy3
Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_molecule_ch1: total RNA
Sample_molecule_ch2: total RNA
Sample_organism_ch1: Homo sapiens
Sample_organism_ch2: Homo sapiens
Sample_platform_id: GPL1001
Sample_scan_protocol: Fluorescent array images were collected
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.
Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 ce
lls
Sample_source_name_ch2: Universal human reference RNA
Sample_title: Human bone marrow stromal cells, HS-5 ce
lls, replicate 1
Column Header Definitions
% > CH1_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of
% > CH2_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of the background over the background signal
AREA: Number of pixels used to calculate a fea
ture's intensity
BKD_AREA: Number of pixles used to calculate a fea
ture's background
CH1_BKD_ Mean: Channel 1 mean background intensity
CH1_BKD_ Median: Channel 1 median background intensity
CH1_BKD_ SD: Channel 1 background standard deviation
CH1_Mean: Channel 1 mean intensity
CH1_Mean - CH1_BKD_: Channel 1 mean signal
CH1_Median: Channel 1 median intensity
CH1_Median - CH1_BKD_: Channel 1 median signal
CH1_SD: Channel 1 mean standard deviation
CH2_BKD_ Mean: Channel 2 mean background intensity
CH2_BKD_ Median: Channel 2 median background intensity
CH2_BKD_ SD: Channel 2 background standard deviation
CH2_Mean: Channel 2 mean intensity
CH2_Mean - CH2_BKD_: Channel 2 mean signal
CH2_Median: Channel 2 median intensity
CH2_Median - CH2_BKD_: Channel 2 median signal
CH2_SD: Channel 2 mean standard deviation
Flags: 0 denotes satisfactory features, while <
0 denotes features that did not meet
ID_REF:
Ratio of Means: Unnormalized, untransformed ratio of mea
ns
VALUE: Normalized log2 ratio of means defined a
s CH1 divided by CH2
0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags
1: 1 17.51 36 38 9 37 38 8 5 45 46 9 46 47 10 0 100000 80 500 -1 -1 1 0 -50
2: 2 -0.10 42 47 19 37 39 11 12 64 65 15 45 47 10 43 0.5 32 176 5 19 10 20 -50
3: 3 -0.42 44 48 18 36 38 8 37 75 75 17 45 46 10 71 0.4 32 176 8 30 12 30 -50
4: 4 17.51 37 40 11 37 39 10 11 42 43 8 43 43 8 2 100000 80 498 0 -1 3 0 -50
5: 5 0.95 147 193 125 37 39 8 98 157 194 109 43 44 9 98 1.033 52 398 110 114 156 151 0
6: 6 0.79 57 62 21 37 39 9 55 69 71 14 44 45 8 76 0.926 52 329 20 25 25 27 -50
7: 7 0.12 45 48 16 37 40 10 28 64 64 14 45 46 9 50 0.579 32 224 8 19 11 19 -50
8: 8 0.68 54 54 17 36 38 9 48 63 64 13 43 44 8 57 0.857 80 510 18 20 18 21 -50
9: 9 -0.10 51 53 16 36 38 9 44 73 77 19 43 44 9 84 0.5 52 406 15 30 17 34 -50
10: 10 0.15 47 50 15 37 39 8 38 65 65 14 43 44 9 63 0.591 52 332 10 22 13 22 -50
11: 11 -1.42 38 40 12 37 39 10 9 58 60 13 45 47 10 31 0.2 32 148 1 13 3 15 -50
12: 12 -0.58 44 47 15 37 39 9 22 70 71 16 43 44 9 70 0.357 80 506 7 27 10 28 -50
13: 13 0.08 63 63 24 36 38 9 63 85 91 21 43 44 9 94 0.563 52 382 27 42 27 48 0
14: 14 -1.05 63 69 23 37 38 9 69 168 167 32 43 45 8 100 0.258 52 382 26 125 32 124 0
15: 15 1.02 439 452 225 37 39 9 98 428 425 198 43 44 8 93 1.086 80 546 402 385 415 382 0
16: 16 2.07 86 91 30 37 39 9 88 66 67 15 43 44 8 70 2.25 80 540 49 23 54 24 0
17: 17 -0.79 40 44 14 36 39 10 11 67 69 15 43 44 9 73 0.308 52 384 4 24 8 26 -50
18: 18 -0.57 50 51 16 37 39 10 37 79 82 22 43 44 9 83 0.359 80 570 13 36 14 39 -50
19: 19 1.90 37 39 10 37 39 10 5 44 44 8 43 44 9 1 2 80 475 0 1 2 1 -50
20: 20 -0.99 42 44 11 37 39 9 9 65 69 16 43 45 9 61 0.269 52 388 5 22 7 26 -50
GEO Type: SAMPLE
GEO Id: HS-27a cells
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-27a
Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.
Sample_data_processing: After background correction and removal
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.
Sample_description: Human bone marrow stromal cells, HS-27a
cells
Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.
Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH,
Tris was removed from the reaction with a Microcon-30 concentrator.
Sample_growth_protocol_ch1: HS-27a cells cultured in RPMI medium 164
0 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000
cells/flask. They were cultured for 3 days and harvested by trypsinization follo
wed by pelleting of the cells.
Sample_label_ch1: Cy5
Sample_label_ch2: Cy3
Sample_label_protocol_ch1: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.
Sample_label_protocol_ch2: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.
Sample_molecule_ch1: total RNA
Sample_molecule_ch2: total RNA
Sample_organism_ch1: Homo sapiens
Sample_organism_ch2: Homo sapiens
Sample_platform_id: GPL1001
Sample_scan_protocol: Fluorescent array images were collected
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.
Sample_source_name_ch1: Human bone marrow stromal cells, HS-27a
Sample_source_name_ch2: Universal human reference RNA
Sample_title: HS-27a cells.
Column Header Definitions
% > CH1_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of
% > CH2_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of the background over the background signal
AREA: Number of pixels used to calculate a fea
ture's intensity
BKD_AREA: Number of pixles used to calculate a fea
ture's background
CH1_BKD_ Mean: Channel 1 mean background intensity
CH1_BKD_ Median: Channel 1 median background intensity
CH1_BKD_ SD: Channel 1 background standard deviation
CH1_Mean: Channel 1 mean intensity
CH1_Mean - CH1_BKD_: Channel 1 mean signal
CH1_Median: Channel 1 median intensity
CH1_Median - CH1_BKD_: Channel 1 median signal
CH1_SD: Channel 1 mean standard deviation
CH2_BKD_ Mean: Channel 2 mean background intensity
CH2_BKD_ Median: Channel 2 median background intensity
CH2_BKD_ SD: Channel 2 background standard deviation
CH2_Mean: Channel 2 mean intensity
CH2_Mean - CH2_BKD_: Channel 2 mean signal
CH2_Median: Channel 2 median intensity
CH2_Median - CH2_BKD_: Channel 2 median signal
CH2_SD: Channel 2 mean standard deviation
Flags: 0 denotes satisfactory features, while <
0 denotes features that did not meet
ID_REF:
Ratio of Means: Unnormalized, untransformed ratio of mea
ns
VALUE: Normalized log2 ratio of means defined a
s CH1 divided by CH2
0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags
1: 1 17.07 36 40 11 37 40 12 5 39 38 5 38 39 6 1 100000 80 540 -1 1 3 0 -50
2: 2 -0.25 47 51 18 37 39 10 30 60 62 15 39 39 6 71 0.609 52 408 10 21 14 23 -50
3: 3 -0.53 46 49 16 37 40 12 15 62 62 13 38 39 5 86 0.5 52 318 9 24 12 24 -50
4: 4 17.07 36 40 12 36 40 12 10 39 39 6 39 39 6 5 100000 80 489 0 0 4 0 -50
5: 5 1.28 178 251 175 36 41 12 95 116 161 103 39 39 6 95 1.762 80 476 142 77 215 122 0
6: 6 0.83 56 64 31 37 41 18 32 57 60 18 39 39 7 57 1.286 80 514 19 18 27 21 -50
7: 7 0.86 59 63 32 38 40 12 32 55 58 14 39 39 7 57 1.316 52 382 21 16 25 19 -50
8: 8 2.12 124 144 75 37 40 12 95 72 73 15 39 39 6 88 3.147 80 554 87 33 107 34 0
9: 9 -0.24 59 66 26 36 40 12 48 92 87 19 38 39 6 96 0.612 52 400 23 54 30 49 -50
10: 10 0.64 63 63 20 37 40 11 53 58 61 12 38 39 6 75 1.13 80 502 26 20 26 23 -50
11: 11 0.39 50 57 21 38 41 12 31 57 58 11 38 39 7 62 0.95 32 171 12 19 19 20 -50
12: 12 -0.05 57 59 21 38 42 15 25 69 69 13 39 40 6 96 0.7 52 330 19 30 21 30 -50
13: 13 -0.30 76 77 28 37 40 13 67 106 107 20 39 40 6 100 0.588 52 390 39 67 40 68 0
14: 14 0.11 166 170 60 36 39 12 100 210 210 38 39 39 7 100 0.784 52 380 130 171 134 171 0
15: 15 0.92 1356 1345 447 38 42 15 100 1004 993 331 39 40 10 100 1.37 52 380 1318 965 1307 954 0
16: 16 2.92 183 193 62 39 42 12 100 66 67 14 39 39 6 88 5.5 80 476 144 27 154 28 0
17: 17 -0.12 54 58 17 36 39 12 36 70 71 14 38 39 6 93 0.667 80 535 18 32 22 33 -50
18: 18 -1.08 59 62 24 36 39 11 51 109 114 36 38 39 5 100 0.342 80 466 23 71 26 76 -50
19: 19 17.07 36 41 13 38 41 11 11 39 38 5 38 39 5 1 100000 80 485 -2 1 3 0 -50
20: 20 0.05 50 52 20 37 41 24 5 56 58 16 38 39 7 63 0.75 52 371 13 18 15 20 -50
GEO Type: SAMPLE
GEO Id: HS-5 cells rep2
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5
Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.
Sample_data_processing: After background correction and removal
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.
Sample_description: Human bone marrow stromal cells, HS-5 ce
lls
Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.
Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH,
Tris was removed from the reaction with a Microcon-30 concentrator.
Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.
Sample_label_ch1: Cy5
Sample_label_ch2: Cy3
Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_molecule_ch1: total RNA
Sample_molecule_ch2: total RNA
Sample_organism_ch1: Homo sapiens
Sample_organism_ch2: Homo sapiens
Sample_platform_id: GPL1001
Sample_scan_protocol: Fluorescent array images were collected
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.
Sample_source_name_ch1: Human bone marrow stromal cells, HS-5
Sample_source_name_ch2: Universal human reference RNA
Sample_title: HS-5 cells, replicate 2
Column Header Definitions
% > CH1_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of
% > CH2_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of the background over the background signal
AREA: Number of pixels used to calculate a fea
ture's intensity
BKD_AREA: Number of pixles used to calculate a fea
ture's background
CH1_BKD_ Mean: Channel 1 mean background intensity
CH1_BKD_ Median: Channel 1 median background intensity
CH1_BKD_ SD: Channel 1 background standard deviation
CH1_Mean: Channel 1 mean intensity
CH1_Mean - CH1_BKD_: Channel 1 mean signal
CH1_Median: Channel 1 median intensity
CH1_Median - CH1_BKD_: Channel 1 median signal
CH1_SD: Channel 1 mean standard deviation
CH2_BKD_ Mean: Channel 2 mean background intensity
CH2_BKD_ Median: Channel 2 median background intensity
CH2_BKD_ SD: Channel 2 background standard deviation
CH2_Mean: Channel 2 mean intensity
CH2_Mean - CH2_BKD_: Channel 2 mean signal
CH2_Median: Channel 2 median intensity
CH2_Median - CH2_BKD_: Channel 2 median signal
CH2_SD: Channel 2 mean standard deviation
Flags: 0 denotes satisfactory features, while <
0 denotes features that did not meet
ID_REF:
Ratio of Means: Unnormalized, untransformed ratio of mea
ns
VALUE: Normalized log2 ratio of means defined a
s CH1 divided by CH2
0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags
1: 1 3.74 39 44 16 37 40 13 10 42 42 8 41 42 8 2 7 80 473 2 1 7 1 -50
2: 2 -0.14 46 46 15 37 40 13 10 57 58 14 39 40 7 53 0.474 80 549 9 18 9 19 -50
3: 3 -0.31 47 47 18 36 40 13 16 65 66 18 40 41 7 75 0.423 80 554 11 25 11 26 -50
4: 4 3.74 40 43 12 36 40 12 10 40 40 7 39 40 8 1 7 80 480 4 1 7 1 -50
5: 5 0.60 74 91 55 37 41 14 60 95 108 45 40 41 8 93 0.794 80 532 37 55 54 68 0
6: 6 0.86 60 58 19 38 42 14 33 59 60 14 39 40 8 60 0.952 80 555 22 20 20 21 -50
7: 7 0.67 47 48 14 38 42 14 7 50 52 11 40 41 8 30 0.833 52 392 9 10 10 12 -50
8: 8 0.71 51 56 22 38 41 13 31 62 61 14 40 41 7 66 0.857 80 516 13 22 18 21 -50
9: 9 0.09 49 52 18 37 40 13 21 67 67 18 40 41 7 75 0.556 120 699 12 27 15 27 -50
10: 10 -0.29 45 49 16 40 44 16 9 62 62 14 41 42 10 53 0.429 32 232 5 21 9 21 -50
11: 11 -0.18 42 46 15 40 44 15 10 52 52 11 39 40 8 33 0.462 80 488 2 13 6 13 -50
12: 12 -0.87 45 49 18 39 42 15 10 75 75 15 40 41 8 88 0.286 80 521 6 35 10 35 -50
13: 13 -0.04 64 69 27 37 41 13 51 100 102 23 39 41 8 98 0.508 80 467 27 61 32 63 -50
14: 14 -1.75 58 63 22 37 41 14 38 206 208 43 40 41 8 100 0.155 80 468 21 166 26 168 -50
15: 15 1.32 643 731 413 38 42 15 100 543 569 218 40 41 7 100 1.31 80 537 605 503 693 529 0
16: 16 2.58 162 168 74 37 41 13 98 80 83 22 41 42 8 93 3.119 80 458 125 39 131 42 0
17: 17 -0.75 42 46 15 37 40 12 12 67 69 16 40 41 8 82 0.31 80 470 5 27 9 29 -50
18: 18 -1.39 41 45 16 38 41 13 8 67 75 29 40 41 9 68 0.2 80 555 3 27 7 35 -50
19: 19 0.00 40 42 14 37 40 12 10 39 39 7 40 40 7 2 -5 80 464 3 -1 5 -1 -50
20: 20 -0.65 38 42 15 37 40 14 3 53 55 13 40 41 8 37 0.333 80 549 1 13 5 15 -50
Testing Bio.Geo on soft_ex_family.txt
GEO Type: PLATFORM
GEO Id: GEO Human 15K v2.0
Platform_coating: unknown
Platform_contributor: Jane,Doe
Platform_contributor: John,A,Smith
Platform_contributor: Hans,van Elton
Platform_contributor: John,Smithers Jr
Platform_contributor: Jie,D,Chen
Platform_description: This set includes 13971 oligonucleotides
, mostly 70-mers, designed based upon representative sequences in build 155 of t
he human UniGene database.
Platform_distribution: non-commercial
Platform_manufacture_protocol: as described in GEO Labs manual
Platform_manufacturer: GEO Labs
Platform_organism: Homo sapiens
Platform_pubmed_id: 123456789
Platform_support: glass
Platform_technology: spotted oligonucleotide
Platform_title: Human 15K long oligo array version 2.0
Platform_web_link: http://geo.best-arrays.org
Column Header Definitions
COLUMN: Column within array
FLAG: Passed validation
GB_ACC: GenBank accession number of sequence use
d to design oligonucleotide probe LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez
/query.fcgi?cmd
GENE_NAME: Descriptive gene name, from UniGene Buil
d 155
GENE_SYMBOL: Gene symbol, from UniGene Build 155
ID:
LOCUSLINK: LocusLink identifier LINK_PRE:"http://
www.ncbi.nlm.nih.gov/LocusLink/LocRpt.cgi?l
PLATE_ID: Plate identifier
ROW: Row within array
SEQUENCE: Sequence of oligonucleotide probe
TIP_ID: Print tip ID
UNIGENE: UniGene cluster ID, Build 155 LINK_PRE
:"http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG
0: ID GB_ACC GENE_NAME UNIGENE LOCUSLINK GENE_SYMBOL TIP_ID ROW COLUMN PLATE_ID FLAG SEQUENCE
1: 1 NM_012115 CASP8 associated protein 2 122843 9994 CASP8AP2 1 1 1 HK1A1 1 GAGGGCCATCATTTAAAACATTTGCATATTTAGCCGCCAAGTTGGATAAAAATCCAAATCAGGTCTCAGA
2: 2 AF035444 tumor suppressing subtransferable candidate 3 154036 7262 TSSC3 5 1 1 HK1A2 1 CTCATCCAGTCATGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGT
3: 3 AK001420 PEF protein with a long N-terminal hydrophobic domain (peflin) 241531 23578 PEF 1 3 1 HK1A3 1 AATCTGACCAAGCATGAGAGAGATCTGTCTATGGGACCAGTGGCTTGGATTCTGCCACACCCATAAATCC
4: 4 M55150 fumarylacetoacetate hydrolase (fumarylacetoacetase) 73875 2184 FAH 5 3 1 HK1A4 1 TCCTGCCATCATGAGATTTTCTCTGCTCTTCTGGAAACAAAGGGCTCAAGCACCCCTTTCAACCCTGTGA
5: 5 AL121964 1 5 1 HK1A5 1 TCCCTGTGAAACTTTGGTTTCTTTCTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATG
6: 6 NM_012094 peroxiredoxin 5 31731 25824 PRDX5 5 5 1 HK1A6 1 AATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCA
7: 7 AK001917 programmed cell death 6 80019 10016 PDCD6 1 7 1 HK1A7 1 TGTCACGTGGGGACCCAGCTGTACATATGTGGATAAGCTGATTAATGGTTTTGCAACTGTAATAGTAGCT
8: 8 AF135794 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 278582 10000 AKT3 5 7 1 HK1A8 1 CTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGC
9: 9 U43342 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 248037 4773 NFATC2 1 9 1 HK1A9 1 CTACTTGGATGATGTTAATGAAATTATCAGGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAA
10: 10 AF067724 non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) 72050 8382 NME5 5 9 1 HK1A10 1 TTTCATGCTCATGTGTCAGATATGCTTCCCTCAAACCTTGTTACAGCATCATCACATTACCTGTTTGATG
11: 11 M13452 lamin A/C 77886 4000 LMNA 1 11 1 HK1A11 1 GAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAATACACTAGTTGTTTCT
12: 12 AJ242832 calpain 11 225953 11131 CAPN11 5 11 1 HK1A12 1 TGAACAACAAGGTAATGCAGGTCCTGGTGGCCAGGTATGCAGATGATGACCTGATCATAGACTTTGACAG
13: 13 AF041378 cell death-inducing DFFA-like effector a 249129 1149 CIDEA 2 1 1 HK1B1 1 AGGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTACGACATCCG
14: 14 AF014955 programmed cell death 5 166468 9141 PDCD5 6 1 1 HK1B2 1 GAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGG
15: 15 D50857 dedicator of cyto-kinesis 1 82295 1793 DOCK1 2 3 1 HK1B3 1 TGTTCCAGCCGGTGGTGTGACTTCGTTGGTTGAGGTGTGTCTCCAACCTACATCAGACCATGAAGTTCAA
16: 16 AB011414 Kruppel-type zinc finger (C2H2) 142150 10224 ZK1 6 3 1 HK1B4 1 TGATACCTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATGTT
17: 17 AF064019 DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) 133089 1677 DFFB 2 5 1 HK1B5 1 CGGTCTGGAAGGAAACACGCGGATCTGAACAGCAGTAATCCTGGGGGATACGGGGGTTGGGCTAGATTAC
18: 18 U83857 apoptosis inhibitor 5 227913 8539 API5 6 5 1 HK1B6 1 TCACCGTTCCCCTTCCCTTTCGTAAGGCAATAGTGCACAACTTAGGTTATTTTTGCTTCCGAATTTGAAT
19: 19 J05243 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 77196 6709 SPTAN1 2 7 1 HK1B7 1 TAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGACCCAG
20: 20 AB014541 apoptosis-associated tyrosine kinase 128316 9625 AATK 6 7 1 HK1B8 1 ATGTAAAGTTTATTGTTGCTTCGCAGGGGGATTTGTTTTGTGTTTTGTTTGAGGCTTAGAACGCTGGTGC
GEO Type: SAMPLE
GEO Id: HS-5 cells rep 1
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5
Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.
Sample_data_processing: After background correction and removal
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.
Sample_description: Human bone marrow stromal cells, HS-5 ce
lls
Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.
Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH,
Tris was removed from the reaction with a Microcon-30 concentrator.
Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.
Sample_label_ch1: Cy5
Sample_label_ch2: Cy3
Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_molecule_ch1: total RNA
Sample_molecule_ch2: total RNA
Sample_organism_ch1: Homo sapiens
Sample_organism_ch2: Homo sapiens
Sample_platform_id: GEO Human 15K v2.0
Sample_scan_protocol: Fluorescent array images were collected
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.
Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 ce
lls
Sample_source_name_ch2: Universal human reference RNA
Sample_title: Human bone marrow stromal cells, HS-5 ce
lls, replicate 1
Column Header Definitions
% > CH1_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of
% > CH2_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of the background over the background signal
AREA: Number of pixels used to calculate a fea
ture's intensity
BKD_AREA: Number of pixles used to calculate a fea
ture's background
CH1_BKD_ Mean: Channel 1 mean background intensity
CH1_BKD_ Median: Channel 1 median background intensity
CH1_BKD_ SD: Channel 1 background standard deviation
CH1_Mean: Channel 1 mean intensity
CH1_Mean - CH1_BKD_: Channel 1 mean signal
CH1_Median: Channel 1 median intensity
CH1_Median - CH1_BKD_: Channel 1 median signal
CH1_SD: Channel 1 mean standard deviation
CH2_BKD_ Mean: Channel 2 mean background intensity
CH2_BKD_ Median: Channel 2 median background intensity
CH2_BKD_ SD: Channel 2 background standard deviation
CH2_Mean: Channel 2 mean intensity
CH2_Mean - CH2_BKD_: Channel 2 mean signal
CH2_Median: Channel 2 median intensity
CH2_Median - CH2_BKD_: Channel 2 median signal
CH2_SD: Channel 2 mean standard deviation
Flags: 0 denotes satisfactory features, while <
0 denotes features that did not meet
ID_REF:
Ratio of Means: Unnormalized, untransformed ratio of mea
ns
VALUE: Normalized log2 ratio of means defined a
s CH1 divided by CH2
0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags
1: 1 17.51 36 38 9 37 38 8 5 45 46 9 46 47 10 0 100000 80 500 -1 -1 1 0 -50
2: 2 -0.10 42 47 19 37 39 11 12 64 65 15 45 47 10 43 0.5 32 176 5 19 10 20 -50
3: 3 -0.42 44 48 18 36 38 8 37 75 75 17 45 46 10 71 0.4 32 176 8 30 12 30 -50
4: 4 17.51 37 40 11 37 39 10 11 42 43 8 43 43 8 2 100000 80 498 0 -1 3 0 -50
5: 5 0.95 147 193 125 37 39 8 98 157 194 109 43 44 9 98 1.033 52 398 110 114 156 151 0
6: 6 0.79 57 62 21 37 39 9 55 69 71 14 44 45 8 76 0.926 52 329 20 25 25 27 -50
7: 7 0.12 45 48 16 37 40 10 28 64 64 14 45 46 9 50 0.579 32 224 8 19 11 19 -50
8: 8 0.68 54 54 17 36 38 9 48 63 64 13 43 44 8 57 0.857 80 510 18 20 18 21 -50
9: 9 -0.10 51 53 16 36 38 9 44 73 77 19 43 44 9 84 0.5 52 406 15 30 17 34 -50
10: 10 0.15 47 50 15 37 39 8 38 65 65 14 43 44 9 63 0.591 52 332 10 22 13 22 -50
11: 11 -1.42 38 40 12 37 39 10 9 58 60 13 45 47 10 31 0.2 32 148 1 13 3 15 -50
12: 12 -0.58 44 47 15 37 39 9 22 70 71 16 43 44 9 70 0.357 80 506 7 27 10 28 -50
13: 13 0.08 63 63 24 36 38 9 63 85 91 21 43 44 9 94 0.563 52 382 27 42 27 48 0
14: 14 -1.05 63 69 23 37 38 9 69 168 167 32 43 45 8 100 0.258 52 382 26 125 32 124 0
15: 15 1.02 439 452 225 37 39 9 98 428 425 198 43 44 8 93 1.086 80 546 402 385 415 382 0
16: 16 2.07 86 91 30 37 39 9 88 66 67 15 43 44 8 70 2.25 80 540 49 23 54 24 0
17: 17 -0.79 40 44 14 36 39 10 11 67 69 15 43 44 9 73 0.308 52 384 4 24 8 26 -50
18: 18 -0.57 50 51 16 37 39 10 37 79 82 22 43 44 9 83 0.359 80 570 13 36 14 39 -50
19: 19 1.90 37 39 10 37 39 10 5 44 44 8 43 44 9 1 2 80 475 0 1 2 1 -50
20: 20 -0.99 42 44 11 37 39 9 9 65 69 16 43 45 9 61 0.269 52 388 5 22 7 26 -50
GEO Type: SAMPLE
GEO Id: HS-27a cells
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-27a
Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.
Sample_data_processing: After background correction and removal
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.
Sample_description: Human bone marrow stromal cells, HS-27a
cells
Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.
Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH,
Tris was removed from the reaction with a Microcon-30 concentrator.
Sample_growth_protocol_ch1: HS-27a cells cultured in RPMI medium 164
0 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000
cells/flask. They were cultured for 3 days and harvested by trypsinization follo
wed by pelleting of the cells.
Sample_label_ch1: Cy5
Sample_label_ch2: Cy3
Sample_label_protocol_ch1: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.
Sample_label_protocol_ch2: The cDNA from HS-27a RNA and Human Unive
rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors,
respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2
.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi
th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m
l of poly-A for hybridization to the microarray.
Sample_molecule_ch1: total RNA
Sample_molecule_ch2: total RNA
Sample_organism_ch1: Homo sapiens
Sample_organism_ch2: Homo sapiens
Sample_platform_id: GEO Human 15K v2.0
Sample_scan_protocol: Fluorescent array images were collected
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.
Sample_source_name_ch1: Human bone marrow stromal cells, HS-27a
Sample_source_name_ch2: Universal human reference RNA
Sample_title: HS-27a cells.
Column Header Definitions
% > CH1_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of
% > CH2_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of the background over the background signal
AREA: Number of pixels used to calculate a fea
ture's intensity
BKD_AREA: Number of pixles used to calculate a fea
ture's background
CH1_BKD_ Mean: Channel 1 mean background intensity
CH1_BKD_ Median: Channel 1 median background intensity
CH1_BKD_ SD: Channel 1 background standard deviation
CH1_Mean: Channel 1 mean intensity
CH1_Mean - CH1_BKD_: Channel 1 mean signal
CH1_Median: Channel 1 median intensity
CH1_Median - CH1_BKD_: Channel 1 median signal
CH1_SD: Channel 1 mean standard deviation
CH2_BKD_ Mean: Channel 2 mean background intensity
CH2_BKD_ Median: Channel 2 median background intensity
CH2_BKD_ SD: Channel 2 background standard deviation
CH2_Mean: Channel 2 mean intensity
CH2_Mean - CH2_BKD_: Channel 2 mean signal
CH2_Median: Channel 2 median intensity
CH2_Median - CH2_BKD_: Channel 2 median signal
CH2_SD: Channel 2 mean standard deviation
Flags: 0 denotes satisfactory features, while <
0 denotes features that did not meet
ID_REF:
Ratio of Means: Unnormalized, untransformed ratio of mea
ns
VALUE: Normalized log2 ratio of means defined a
s CH1 divided by CH2
0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags
1: 1 17.07 36 40 11 37 40 12 5 39 38 5 38 39 6 1 100000 80 540 -1 1 3 0 -50
2: 2 -0.25 47 51 18 37 39 10 30 60 62 15 39 39 6 71 0.609 52 408 10 21 14 23 -50
3: 3 -0.53 46 49 16 37 40 12 15 62 62 13 38 39 5 86 0.5 52 318 9 24 12 24 -50
4: 4 17.07 36 40 12 36 40 12 10 39 39 6 39 39 6 5 100000 80 489 0 0 4 0 -50
5: 5 1.28 178 251 175 36 41 12 95 116 161 103 39 39 6 95 1.762 80 476 142 77 215 122 0
6: 6 0.83 56 64 31 37 41 18 32 57 60 18 39 39 7 57 1.286 80 514 19 18 27 21 -50
7: 7 0.86 59 63 32 38 40 12 32 55 58 14 39 39 7 57 1.316 52 382 21 16 25 19 -50
8: 8 2.12 124 144 75 37 40 12 95 72 73 15 39 39 6 88 3.147 80 554 87 33 107 34 0
9: 9 -0.24 59 66 26 36 40 12 48 92 87 19 38 39 6 96 0.612 52 400 23 54 30 49 -50
10: 10 0.64 63 63 20 37 40 11 53 58 61 12 38 39 6 75 1.13 80 502 26 20 26 23 -50
11: 11 0.39 50 57 21 38 41 12 31 57 58 11 38 39 7 62 0.95 32 171 12 19 19 20 -50
12: 12 -0.05 57 59 21 38 42 15 25 69 69 13 39 40 6 96 0.7 52 330 19 30 21 30 -50
13: 13 -0.30 76 77 28 37 40 13 67 106 107 20 39 40 6 100 0.588 52 390 39 67 40 68 0
14: 14 0.11 166 170 60 36 39 12 100 210 210 38 39 39 7 100 0.784 52 380 130 171 134 171 0
15: 15 0.92 1356 1345 447 38 42 15 100 1004 993 331 39 40 10 100 1.37 52 380 1318 965 1307 954 0
16: 16 2.92 183 193 62 39 42 12 100 66 67 14 39 39 6 88 5.5 80 476 144 27 154 28 0
17: 17 -0.12 54 58 17 36 39 12 36 70 71 14 38 39 6 93 0.667 80 535 18 32 22 33 -50
18: 18 -1.08 59 62 24 36 39 11 51 109 114 36 38 39 5 100 0.342 80 466 23 71 26 76 -50
19: 19 17.07 36 41 13 38 41 11 11 39 38 5 38 39 5 1 100000 80 485 -2 1 3 0 -50
20: 20 0.05 50 52 20 37 41 24 5 56 58 16 38 39 7 63 0.75 52 371 13 18 15 20 -50
GEO Type: SAMPLE
GEO Id: HS-5 cells rep2
Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5
Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S
tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap
proximating the expression profile of the majority of human genes was used.
Sample_data_processing: After background correction and removal
of flagged values, log base 2 expression ratios were mean centered and linear tr
ansformed to obtain the log and linear values given in the data table.
Sample_description: Human bone marrow stromal cells, HS-5 ce
lls
Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag
en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1
8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f
or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d
TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re
moved from the reaction with a Microcon-30 concentrator.
Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o
ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran
scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT
P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH,
Tris was removed from the reaction with a Microcon-30 concentrator.
Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640
containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce
lls/flask. They were cultured for 3 days and harvested by trypsinization followe
d by pelleting of the cells.
Sample_label_ch1: Cy5
Sample_label_ch2: Cy3
Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers
al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r
espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7
M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with
a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml
of poly-A for hybridization to the microarray.
Sample_molecule_ch1: total RNA
Sample_molecule_ch2: total RNA
Sample_organism_ch1: Homo sapiens
Sample_organism_ch2: Homo sapiens
Sample_platform_id: GEO Human 15K v2.0
Sample_scan_protocol: Fluorescent array images were collected
for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit
y data were extracted and analyzed with GenePix Pro 3.0 analysis software.
Sample_source_name_ch1: Human bone marrow stromal cells, HS-5
Sample_source_name_ch2: Universal human reference RNA
Sample_title: HS-5 cells, replicate 2
Column Header Definitions
% > CH1_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of
% > CH2_BKD_+2SD: Percent of feature pixels that were grea
ter than two standard deviations of the background over the background signal
AREA: Number of pixels used to calculate a fea
ture's intensity
BKD_AREA: Number of pixles used to calculate a fea
ture's background
CH1_BKD_ Mean: Channel 1 mean background intensity
CH1_BKD_ Median: Channel 1 median background intensity
CH1_BKD_ SD: Channel 1 background standard deviation
CH1_Mean: Channel 1 mean intensity
CH1_Mean - CH1_BKD_: Channel 1 mean signal
CH1_Median: Channel 1 median intensity
CH1_Median - CH1_BKD_: Channel 1 median signal
CH1_SD: Channel 1 mean standard deviation
CH2_BKD_ Mean: Channel 2 mean background intensity
CH2_BKD_ Median: Channel 2 median background intensity
CH2_BKD_ SD: Channel 2 background standard deviation
CH2_Mean: Channel 2 mean intensity
CH2_Mean - CH2_BKD_: Channel 2 mean signal
CH2_Median: Channel 2 median intensity
CH2_Median - CH2_BKD_: Channel 2 median signal
CH2_SD: Channel 2 mean standard deviation
Flags: 0 denotes satisfactory features, while <
0 denotes features that did not meet
ID_REF:
Ratio of Means: Unnormalized, untransformed ratio of mea
ns
VALUE: Normalized log2 ratio of means defined a
s CH1 divided by CH2
0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags
1: 1 3.74 39 44 16 37 40 13 10 42 42 8 41 42 8 2 7 80 473 2 1 7 1 -50
2: 2 -0.14 46 46 15 37 40 13 10 57 58 14 39 40 7 53 0.474 80 549 9 18 9 19 -50
3: 3 -0.31 47 47 18 36 40 13 16 65 66 18 40 41 7 75 0.423 80 554 11 25 11 26 -50
4: 4 3.74 40 43 12 36 40 12 10 40 40 7 39 40 8 1 7 80 480 4 1 7 1 -50
5: 5 0.60 74 91 55 37 41 14 60 95 108 45 40 41 8 93 0.794 80 532 37 55 54 68 0
6: 6 0.86 60 58 19 38 42 14 33 59 60 14 39 40 8 60 0.952 80 555 22 20 20 21 -50
7: 7 0.67 47 48 14 38 42 14 7 50 52 11 40 41 8 30 0.833 52 392 9 10 10 12 -50
8: 8 0.71 51 56 22 38 41 13 31 62 61 14 40 41 7 66 0.857 80 516 13 22 18 21 -50
9: 9 0.09 49 52 18 37 40 13 21 67 67 18 40 41 7 75 0.556 120 699 12 27 15 27 -50
10: 10 -0.29 45 49 16 40 44 16 9 62 62 14 41 42 10 53 0.429 32 232 5 21 9 21 -50
11: 11 -0.18 42 46 15 40 44 15 10 52 52 11 39 40 8 33 0.462 80 488 2 13 6 13 -50
12: 12 -0.87 45 49 18 39 42 15 10 75 75 15 40 41 8 88 0.286 80 521 6 35 10 35 -50
13: 13 -0.04 64 69 27 37 41 13 51 100 102 23 39 41 8 98 0.508 80 467 27 61 32 63 -50
14: 14 -1.75 58 63 22 37 41 14 38 206 208 43 40 41 8 100 0.155 80 468 21 166 26 168 -50
15: 15 1.32 643 731 413 38 42 15 100 543 569 218 40 41 7 100 1.31 80 537 605 503 693 529 0
16: 16 2.58 162 168 74 37 41 13 98 80 83 22 41 42 8 93 3.119 80 458 125 39 131 42 0
17: 17 -0.75 42 46 15 37 40 12 12 67 69 16 40 41 8 82 0.31 80 470 5 27 9 29 -50
18: 18 -1.39 41 45 16 38 41 13 8 67 75 29 40 41 9 68 0.2 80 555 3 27 7 35 -50
19: 19 0.00 40 42 14 37 40 12 10 39 39 7 40 40 7 2 -5 80 464 3 -1 5 -1 -50
20: 20 -0.65 38 42 15 37 40 14 3 53 55 13 40 41 8 37 0.333 80 549 1 13 5 15 -50
GEO Type: SERIES
GEO Id: Bone_marrow_stromal_cells
Series_contributor: Jane,,Doe
Series_contributor: John,A,Smith
Series_overall_design: We analyzed 2 arrays for HS-5 cell line
and 1 array for HS-27a cell line
Series_pubmed_id: 123456789
Series_sample_id: HS-5 cells rep1
Series_sample_id: HS-27a cells
Series_sample_id: HS-5 cells rep2
Series_summary: Two human stromal cell lines, HS-5 and H
S-27a, represent functionally distinct components of the bone marrow microenviro
nment.1,2 HS-27a supports cobblestone area formation by early hematopoietic prog
enitors, whereas HS-5 secretes multiple cytokines that support the proliferation
of committed progenitors. These cell lines have been distributed to research gr
oups worldwide for use as a tool to understand interactions between hematopoieti
c cells and their microenvironment. We have used DNA microarray technology to ch
aracterize and compare the expression of over 17 000 genes in these cell lines.
Gene expression differences in cytokines/chemokines, G-protein signaling molecul
es, and multiple extracellular matrix proteins add to the known protein and func
tional characterization of the lines, leading to new insight into the difference
s in their support function for hematopoietic progenitors.
Series_title: Profiling of the functionally distinct h
uman bone marrow stromal cell lines HS-5 and HS-27a.
Series_type: other
Series_web_link: http://geo.best-arrays.org
Column Header Definitions
Testing Bio.Geo on soft_ex_platform.txt
GEO Type: PLATFORM
GEO Id: GEO Human 14K v 1.0
Platform_coating: unknown
Platform_contributor: Jane,,Doe
Platform_contributor: John,A,Smith
Platform_contributor: Hans,van Elton
Platform_contributor: John,Smithers Jr
Platform_contributor: Jie,D,Chen
Platform_description: This set includes 13971 oligonucleotides
, mostly 70-mers, designed based upon representative sequences in build 155 of t
he human UniGene database.
Platform_distribution: non-commercial
Platform_manufacture_protocol: as described in GEO Labs manual
Platform_manufacturer: GEO Labs
Platform_organism: Homo sapiens
Platform_pubmed_id: 123456789
Platform_support: glass
Platform_technology: spotted oligonucleotide
Platform_title: Human 14K long oligo array
Platform_web_link: http://geo.best-arrays.org
Column Header Definitions
COLUMN: Column within array
FLAG: Passed validation
GB_ACC: GenBank accession number of sequence use
d to design oligonucleotide probe
GENE_NAME: Descriptive gene name, from UniGene Buil
d 155
GENE_SYMBOL: Gene symbol, from UniGene Build 155
ID:
LOCUSLINK: LocusLink identifier
PLATE_ID: Plate identifier
ROW: Row within array
SEQUENCE: Sequence of oligonucleotide probe
TIP_ID: Print tip ID
UNIGENE: UniGene cluster ID, Build 155
0: ID GB_ACC GENE_NAME UNIGENE LOCUSLINK GENE_SYMBOL TIP_ID ROW COLUMN PLATE_ID FLAG SEQUENCE
1: 1 NM_012115 CASP8 associated protein 2 122843 9994 CASP8AP2 1 1 1 HK1A1 1 GAGGGCCATCATTTAAAACATTTGCATATTTAGCCGCCAAGTTGGATAAAAATCCAAATCAGGTCTCAGA
2: 2 AF035444 tumor suppressing subtransferable candidate 3 154036 7262 TSSC3 5 1 1 HK1A2 1 CTCATCCAGTCATGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGT
3: 3 AK001420 PEF protein with a long N-terminal hydrophobic domain (peflin) 241531 23578 PEF 1 3 1 HK1A3 1 AATCTGACCAAGCATGAGAGAGATCTGTCTATGGGACCAGTGGCTTGGATTCTGCCACACCCATAAATCC
4: 4 M55150 fumarylacetoacetate hydrolase (fumarylacetoacetase) 73875 2184 FAH 5 3 1 HK1A4 1 TCCTGCCATCATGAGATTTTCTCTGCTCTTCTGGAAACAAAGGGCTCAAGCACCCCTTTCAACCCTGTGA
5: 5 AL121964 1 5 1 HK1A5 1 TCCCTGTGAAACTTTGGTTTCTTTCTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATG
6: 6 NM_012094 peroxiredoxin 5 31731 25824 PRDX5 5 5 1 HK1A6 1 AATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCA
7: 7 AK001917 programmed cell death 6 80019 10016 PDCD6 1 7 1 HK1A7 1 TGTCACGTGGGGACCCAGCTGTACATATGTGGATAAGCTGATTAATGGTTTTGCAACTGTAATAGTAGCT
8: 8 AF135794 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 278582 10000 AKT3 5 7 1 HK1A8 1 CTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGC
9: 9 U43342 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 248037 4773 NFATC2 1 9 1 HK1A9 1 CTACTTGGATGATGTTAATGAAATTATCAGGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAA
10: 10 AF067724 non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) 72050 8382 NME5 5 9 1 HK1A10 1 TTTCATGCTCATGTGTCAGATATGCTTCCCTCAAACCTTGTTACAGCATCATCACATTACCTGTTTGATG
11: 11 M13452 lamin A/C 77886 4000 LMNA 1 11 1 HK1A11 1 GAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAATACACTAGTTGTTTCT
12: 12 AJ242832 calpain 11 225953 11131 CAPN11 5 11 1 HK1A12 1 TGAACAACAAGGTAATGCAGGTCCTGGTGGCCAGGTATGCAGATGATGACCTGATCATAGACTTTGACAG
13: 13 AF041378 cell death-inducing DFFA-like effector a 249129 1149 CIDEA 2 1 1 HK1B1 1 AGGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTACGACATCCG
14: 14 AF014955 programmed cell death 5 166468 9141 PDCD5 6 1 1 HK1B2 1 GAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGG
15: 15 D50857 dedicator of cyto-kinesis 1 82295 1793 DOCK1 2 3 1 HK1B3 1 TGTTCCAGCCGGTGGTGTGACTTCGTTGGTTGAGGTGTGTCTCCAACCTACATCAGACCATGAAGTTCAA
16: 16 AB011414 Kruppel-type zinc finger (C2H2) 142150 10224 ZK1 6 3 1 HK1B4 1 TGATACCTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATGTT
17: 17 AF064019 DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) 133089 1677 DFFB 2 5 1 HK1B5 1 CGGTCTGGAAGGAAACACGCGGATCTGAACAGCAGTAATCCTGGGGGATACGGGGGTTGGGCTAGATTAC
18: 18 U83857 apoptosis inhibitor 5 227913 8539 API5 6 5 1 HK1B6 1 TCACCGTTCCCCTTCCCTTTCGTAAGGCAATAGTGCACAACTTAGGTTATTTTTGCTTCCGAATTTGAAT
19: 19 J05243 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 77196 6709 SPTAN1 2 7 1 HK1B7 1 TAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGACCCAG
20: 20 AB014541 apoptosis-associated tyrosine kinase 128316 9625 AATK 6 7 1 HK1B8 1 ATGTAAAGTTTATTGTTGCTTCGCAGGGGGATTTGTTTTGTGTTTTGTTTGAGGCTTAGAACGCTGGTGC
Testing Bio.Geo on soft_ex_series.txt
GEO Type: SERIES
GEO Id: Bone_marrow_stromal_cells
Series_contributor: Jane,Doe
Series_contributor: John,A,Smith
Series_contributor: Hans,van Elton
Series_contributor: John,Smithers Jr
Series_contributor: Jie,D,Chen
Series_overall_design: We analyzed 2 arrays for HS-5 cell line
and 2 arrays for HS-27a cell line
Series_pubmed_id: 123456789
Series_sample_id: GSM10001
Series_sample_id: GSM10002
Series_sample_id: GSM10003
Series_sample_id: GSM10004
Series_summary: Two human stromal cell lines, HS-5 and H
S-27a, represent functionally distinct components of the bone marrow microenviro
nment.1,2 HS-27a supports cobblestone area formation by early hematopoietic prog
enitors, whereas HS-5 secretes multiple cytokines that support the proliferation
of committed progenitors. These cell lines have been distributed to research gr
oups worldwide for use as a tool to understand interactions between hematopoieti
c cells and their microenvironment. We have used DNA microarray technology to ch
aracterize and compare the expression of over 17 000 genes in these cell lines.
Gene expression differences in cytokines/chemokines, G-protein signaling molecul
es, and multiple extracellular matrix proteins add to the known protein and func
tional characterization of the lines, leading to new insight into the difference
s in their support function for hematopoietic progenitors.
Series_title: Profiling of the functionally distinct h
uman bone marrow stromal cell lines HS-5 and HS-27a.
Series_type: Cell Line Comparison
Series_variable_1: cell line
Series_variable_2: cell line
Series_variable_description_1: HS-5
Series_variable_description_2: HS-27a
Series_variable_sample_list_1: GSM10001, GSM10002
Series_variable_sample_list_2: GSM10003, GSM10004
Column Header Definitions