test_geo Testing Bio.Geo on GSE16.txt GEO Type: SAMPLE GEO Id: GSM804 Sample_author: Antoine,M,Snijders Sample_author: Norma,,Nowak Sample_author: Richard,,Segraves Sample_author: Stephanie,,Blackwood Sample_author: Nils,,Brown Sample_author: Jeffery,,Conroy Sample_author: Greg,,Hamilton Sample_author: Anna,K,Hindle Sample_author: Bing,,Huey Sample_author: Karen,,Kimura Sample_author: Sindy,,Law Sample_author: Ken,,Myambo Sample_author: Joel,,Palmer Sample_author: Bauke,,Ylstra Sample_author: Jingzhu,P,Yue Sample_author: Joe,W,Gray Sample_author: Ajay,N,Jain Sample_author: Daniel,,Pinkel Sample_author: Donna,G,Albertson Sample_description: Coriell Cell Repositories cell line GM05296. Sample_description: Fibroblast cell line derived from a 1 mo nth old female with multiple congenital malformations, dysmorphic features, intr auterine growth retardation, heart murmur, cleft palate, equinovarus deformity, microcephaly, coloboma of right iris, clinodactyly, reduced RBC catalase activit y, and 1 copy of catalase gene. Sample_description: Chromosome abnormalities are present. Sample_description: Karyotype is 46,XX,-11,+der(11)inv ins(1 1;10)(11pter> 11p13::10q21>10q24::11p13>11qter)mat Sample_organism: Homo sapiens Sample_platform_id: GPL28 Sample_pubmed_id: 11687795 Sample_series_id: GSE16 Sample_status: Public on Feb 12 2002 Sample_submission_date: Jan 17 2002 Sample_submitter_city: San Francisco,CA,94143,USA Sample_submitter_department: Comprehensive Cancer Center Sample_submitter_email: albertson@cc.ucsf.edu Sample_submitter_institute: University of California San Francisco Sample_submitter_name: Donna,G,Albertson Sample_submitter_phone: 415 502-8463 Sample_target_source1: Cell line GM05296 Sample_target_source2: normal male reference genomic DNA Sample_title: CGH_Albertson_GM05296-001218 Sample_type: dual channel genomic Column Header Definitions ID_REF: Unique row identifier, genome position o rder LINEAR_RATIO: Mean of replicate Cy3/Cy5 ratios LOG2STDDEV: Standard deviation of VALUE NO_REPLICATES: Number of replicate spot measurements VALUE: aka LOG2RATIO, mean of log base 2 of LIN EAR_RATIO 0: ID_REF VALUE LINEAR_RATIO LOG2STDDEV NO_REPLICATES 1: 1 1.047765 0.011853 3 2: 2 0 3: 3 0.008824 1.006135 0.00143 3 4: 4 -0.000894 0.99938 0.001454 3 5: 5 0.075875 1.054 0.003077 3 6: 6 0.017303 1.012066 0.005876 2 7: 7 -0.006766 0.995321 0.013881 3 8: 8 0.020755 1.014491 0.005506 3 9: 9 -0.094938 0.936313 0.012662 3 10: 10 -0.054527 0.96291 0.01073 3 11: 11 -0.025057 0.982782 0.003855 3 12: 12 0 13: 13 0.108454 1.078072 0.005196 3 14: 14 0.078633 1.056017 0.009165 3 15: 15 0.098571 1.070712 0.007834 3 16: 16 0.044048 1.031003 0.013651 3 17: 17 0.018039 1.012582 0.005471 3 18: 18 -0.088807 0.9403 0.010571 3 19: 19 0.016349 1.011397 0.007113 3 20: 20 0.030977 1.021704 0.016798 3 Testing Bio.Geo on GSM645.txt GEO Type: SAMPLE GEO Id: GSM645 Sample_author: Reinhard,,Hoffmann Sample_author: Thomas,,Seidl Sample_author: Ton,,Rolink Sample_author: Fritz,,Melchers Sample_description: B220+CD25+sIg- Large Pre BII cells sorte d out of mouse bone marrow, sort no. 8 Sample_organism: Mus musculus Sample_platform_id: GPL22 Sample_series_id: GSE13 Sample_status: Public on Dec 17 2001 Sample_submission_date: Nov 27 2001 Sample_submitter_address: Pettenkoferstr. 9a Sample_submitter_city: Munich,80336,Germany Sample_submitter_department: Bacteriology Sample_submitter_email: r_hoffmann@m3401.mpk.med.uni-muenchen.de Sample_submitter_institute: Max von Pettenkofer Institut Sample_submitter_name: Reinhard,,Hoffmann Sample_submitter_phone: +49-89-5160-5424 Sample_target_source: Large Pre-BII cells Sample_title: Large Pre-BII cells 8b Sample_type: single channel Column Header Definitions ABS_CALL: Whether a probe set is present, marginal , or absent; see Affymetrix Literature Experiment Name: Experiment Name ID_REF: Affymetrix Probe Set Identifier Log Avg: MM Excess: Number of probe peirs where MM/PM exceed s 1/ratio limit (10 by default) NEGATIVE: number of negative probe pairs PAIRS: number of probe set specific probe pairs on the array PAIRS_IN_AVG: Trimmed probe pair set PAIRS_USED: PM Excess: number of probe pairs where PM/MM excee ds the ratio limit (10 by default) POS/NEG: Positive/Negative POSITIVE: number of poisitive probe pairs POS_FRACTION: Positive/Pairs Used VALUE: Average Difference Intensity 0: ID_REF Experiment Name POSITIVE NEGATIVE PAIRS PAIRS_USED PAIRS_IN_AVG POS_FRACTION Log Avg PM Excess MM Excess POS/NEG VALUE ABS_CALL 1: IL2_at RHMu8LarB 4 4 19 19 19 0.21 -0.58 0 0 1.0 -78 A 2: IL10_at RHMu8LarB 7 4 20 20 18 0.35 1.87 1 0 1.8 161 A 3: GMCSF_at RHMu8LarB 4 4 20 20 19 0.20 0.39 0 0 1.0 -11 A 4: TNFRII_at RHMu8LarB 2 2 20 20 18 0.10 0.48 0 0 1.0 52 A 5: MIP1-B_at RHMu8LarB 6 4 20 20 19 0.30 0.43 0 0 1.5 373 A 6: IL4_at RHMu8LarB 3 3 20 20 19 0.15 0.29 0 0 1.0 27 A 7: IL12_P40_at RHMu8LarB 3 5 20 20 19 0.15 -0.22 0 0 0.6 -163 A 8: TNFa_at RHMu8LarB 3 4 20 20 20 0.15 -0.57 1 0 0.8 -95 A 9: TCRa_at RHMu8LarB 1 4 20 20 19 0.05 -0.50 0 0 0.3 -186 A 10: AFFX-BioB-5_at RHMu8LarB 0 1 20 20 19 0.00 0.35 0 0 0.0 120 A 11: AFFX-BioB-M_at RHMu8LarB 0 1 20 20 19 0.00 0.02 0 0 0.0 -13 A 12: AFFX-BioB-3_at RHMu8LarB 2 0 20 20 19 0.10 0.38 0 0 Undef 136 A 13: AFFX-BioC-5_at RHMu8LarB 9 0 20 20 20 0.45 1.33 0 0 Undef 606 P 14: AFFX-BioC-3_at RHMu8LarB 2 0 20 20 19 0.10 0.64 0 0 Undef 257 A 15: AFFX-BioDn-5_at RHMu8LarB 8 0 20 20 20 0.40 1.23 0 0 Undef 380 P 16: AFFX-BioDn-3_at RHMu8LarB 16 0 20 20 19 0.80 2.79 0 0 Undef 2764 P 17: AFFX-CreX-5_at RHMu8LarB 19 0 20 20 19 0.95 5.65 0 0 Undef 4391 P 18: AFFX-CreX-3_at RHMu8LarB 19 0 20 20 20 0.95 6.42 2 0 Undef 10787 P 19: AFFX-BioB-5_st RHMu8LarB 5 3 20 20 19 0.25 0.48 0 0 1.7 80 A 20: AFFX-BioB-M_st RHMu8LarB 2 3 20 20 17 0.10 0.16 0 0 0.7 24 A Testing Bio.Geo on GSM691.txt GEO Type: SAMPLE GEO Id: GSM691 Sample_anchor: NlaIII Sample_author: Jeffrey,,Marks Sample_author: Gregory,J,Riggins Sample_author: Robert,L,Strausberg Sample_description: This library represents a Cancer Genome Anatomy Project library, which was either produced through CGAP funding, or dona ted to CGAP. Sample_description: The Cancer Genome Anatomy Project (CGAP: http://cgap.nci.nih.gov) is an interdisciplinary program established and admini stered by the National Cancer Institute (NCI: http://www.nci.nih.gov) to generat e the information and technological tools needed to decipher the molecular anato my of the cancer cell. Sample_description: Library constructed by Riggins laborator y Tissue supplied by Jeffrey Marks, Ph.D. Sample_description: Organ: Breast Sample_description: Tissue_type: normal epithelial organoids Sample_description: Library treatment: non-normalized Sample_description: Tissue description: Breast, Isolated nor mal epithelial organoids. Derived from a reduction mammoplasty. Sample_description: Tissue supplier: Jeffrey Marks, Ph.D. Sample_description: Sample type: Bulk Sample_description: Producer: Riggins Laboratory Sample_description: Clones generated to date: 768 Sample_description: Sequences generated to date: 572 Sample_organism: Homo sapiens Sample_platform_id: GPL4 Sample_series_id: GSE14 Sample_status: Public on Nov 28 2001 Sample_submission_date: Nov 28 2001 Sample_submitter_city: Bethesda,MD,20892,USA Sample_submitter_department: Cancer Genome Anatomy Project Sample_submitter_email: cgapbs-r@mail.nih.gov Sample_submitter_institute: National Cancer Institute Sample_submitter_name: Robert,L,Strausberg Sample_submitter_phone: 301-496-1550 Sample_submitter_web_link: http://cgap.nci.nih.gov/ Sample_tag_count: 7165 Sample_target_source: Breast, isolated normal epithelial organ oids Sample_title: SAGE_Duke_40N Sample_type: sage Sample_web_link: http://cgap.nci.nih.gov Column Header Definitions COUNT: Absolute tag count TAG: Ten base SAGE tag, LINK_PRE:"http://www. ncbi.nlm.nih.gov/SAGE/SAGEtag.cgi?tag TPM: Tags per million, or (1000000*COUNT)/(To tal tags) 0: TAG COUNT TPM 1: TTGGGGTTTC 202 28192.6 2: TAGGTTGTCT 129 18004.2 3: GAGGGAGTTT 109 15212.8 4: TGCACGTTTT 92 12840.2 5: CTGGGTTAAT 83 11584.1 6: GTTGTGGTTA 82 11444.5 7: GATCCCAACT 63 8792.74 8: TGCAGTCACT 59 8234.47 9: GGATTTGGCC 58 8094.91 10: GGGCTGGGGT 56 7815.77 11: ATAATTCTTT 44 6140.96 12: CTTCCTTGCC 42 5861.83 13: TTGGTCCTCT 40 5582.69 14: GGCAAGCCCC 36 5024.42 15: AACTAAAAAA 34 4745.29 16: AGGGCTTCCA 34 4745.29 17: AGGCTACGGA 33 4605.72 18: GTGAAACCCC 32 4466.15 19: AACTAACAAA 31 4326.59 20: GAAAAATGGT 30 4187.02 Testing Bio.Geo on GSM700.txt GEO Type: SAMPLE GEO Id: GSM700 Sample_anchor: NlaIII Sample_author: Gregory,J,Riggins Sample_author: Robert,L,Strausberg Sample_description: This library represents a Cancer Genome Anatomy Project library, which was either produced through CGAP funding, or dona ted to CGAP. Sample_description: The Cancer Genome Anatomy Project (CGAP: http://cgap.nci.nih.gov) is an interdisciplinary program established and admini stered by the National Cancer Institute (NCI: http://www.nci.nih.gov) to generat e the information and technological tools needed to decipher the molecular anato my of the cancer cell. Sample_description: Cell line grown under 1.5% oxygen condit ions for 24 hours prior to harvesting in zinc option media with 10% RBS and harv ested at passage 102. Library constructed in the laboratory of G. Riggins, M.D., Ph.D. (Duke University). Sample_description: Organ: brain Sample_description: Tissue_type: glioblastoma multiforme Sample_description: Cell_line: H247 Sample_description: Lab host: DH10B Sample_description: Vector: pZErO-1 Sample_description: Vector type: plasmid Sample_description: R. Site 1: Sph1 Sample_description: R. Site 2: Sph1 Sample_description: Library treatment: non-normalized Sample_description: Tissue description: Brain, Duke glioblas toma multiforme cell line, H247, grown under 1.5% oxygen conditions for 24 hour s prior to harvesting. Sample_description: Tissue Sample_organism: Homo sapiens Sample_platform_id: GPL4 Sample_series_id: GSE14 Sample_status: Public on Nov 28 2001 Sample_submission_date: Nov 28 2001 Sample_submitter_city: Bethesda,MD,20892,USA Sample_submitter_department: Cancer Genome Anatomy Project Sample_submitter_email: cgapbs-r@mail.nih.gov Sample_submitter_institute: National Cancer Institute Sample_submitter_name: Robert,L,Strausberg Sample_submitter_phone: 301-496-1550 Sample_submitter_web_link: http://cgap.nci.nih.gov/ Sample_tag_count: 72031 Sample_target_source: Brain, glioblastoma multiforme, cell-lin e H247 Sample_title: SAGE_Duke_H247_Hypoxia Sample_type: sage Sample_web_link: http://cgap.nci.nih.gov Column Header Definitions COUNT: Absolute tag count TAG: Ten base SAGE tag, LINK_PRE:"http://www. ncbi.nlm.nih.gov/SAGE/SAGEtag.cgi?tag TPM: Tags per million, or (1000000*COUNT)/(To tal tags) 0: TAG COUNT TPM 1: TCCAAATCGA 520 7219.11 2: TACCATCAAT 434 6025.18 3: TTGGGGTTTC 389 5400.45 4: CCCATCGTCC 367 5095.03 5: GTGAAACCCC 365 5067.26 6: GGGGAAATCG 357 4956.2 7: CCTGTAATCC 346 4803.49 8: TGATTTCACT 334 4636.89 9: TGTGTTGAGA 315 4373.12 10: GCCCCCAATA 303 4206.52 11: CTAAGACTTC 279 3873.33 12: GCGACCGTCA 276 3831.68 13: TTGGTCCTCT 276 3831.68 14: CCTAGCTGGA 268 3720.62 15: GATGAGGAGA 251 3484.61 16: ACTTTTTCAA 244 3387.43 17: CCACTGCACT 223 3095.89 18: GTGTGTTTGT 223 3095.89 19: GAAATACAGT 218 3026.47 20: GCTTTATTTG 218 3026.47 Testing Bio.Geo on GSM804.txt GEO Type: SAMPLE GEO Id: GSM804 Sample_author: Antoine,M,Snijders Sample_author: Norma,,Nowak Sample_author: Richard,,Segraves Sample_author: Stephanie,,Blackwood Sample_author: Nils,,Brown Sample_author: Jeffery,,Conroy Sample_author: Greg,,Hamilton Sample_author: Anna,K,Hindle Sample_author: Bing,,Huey Sample_author: Karen,,Kimura Sample_author: Sindy,,Law Sample_author: Ken,,Myambo Sample_author: Joel,,Palmer Sample_author: Bauke,,Ylstra Sample_author: Jingzhu,P,Yue Sample_author: Joe,W,Gray Sample_author: Ajay,N,Jain Sample_author: Daniel,,Pinkel Sample_author: Donna,G,Albertson Sample_description: Coriell Cell Repositories cell line GM05296. Sample_description: Fibroblast cell line derived from a 1 mo nth old female with multiple congenital malformations, dysmorphic features, intr auterine growth retardation, heart murmur, cleft palate, equinovarus deformity, microcephaly, coloboma of right iris, clinodactyly, reduced RBC catalase activit y, and 1 copy of catalase gene. Sample_description: Chromosome abnormalities are present. Sample_description: Karyotype is 46,XX,-11,+der(11)inv ins(1 1;10)(11pter> 11p13::10q21>10q24::11p13>11qter)mat Sample_organism: Homo sapiens Sample_platform_id: GPL28 Sample_pubmed_id: 11687795 Sample_series_id: GSE16 Sample_status: Public on Feb 12 2002 Sample_submission_date: Jan 17 2002 Sample_submitter_city: San Francisco,CA,94143,USA Sample_submitter_department: Comprehensive Cancer Center Sample_submitter_email: albertson@cc.ucsf.edu Sample_submitter_institute: University of California San Francisco Sample_submitter_name: Donna,G,Albertson Sample_submitter_phone: 415 502-8463 Sample_target_source1: Cell line GM05296 Sample_target_source2: normal male reference genomic DNA Sample_title: CGH_Albertson_GM05296-001218 Sample_type: dual channel genomic Column Header Definitions ID_REF: Unique row identifier, genome position o rder LINEAR_RATIO: Mean of replicate Cy3/Cy5 ratios LOG2STDDEV: Standard deviation of VALUE NO_REPLICATES: Number of replicate spot measurements VALUE: aka LOG2RATIO, mean of log base 2 of LIN EAR_RATIO 0: ID_REF VALUE LINEAR_RATIO LOG2STDDEV NO_REPLICATES 1: 1 1.047765 0.011853 3 2: 2 0 3: 3 0.008824 1.006135 0.00143 3 4: 4 -0.000894 0.99938 0.001454 3 5: 5 0.075875 1.054 0.003077 3 6: 6 0.017303 1.012066 0.005876 2 7: 7 -0.006766 0.995321 0.013881 3 8: 8 0.020755 1.014491 0.005506 3 9: 9 -0.094938 0.936313 0.012662 3 10: 10 -0.054527 0.96291 0.01073 3 11: 11 -0.025057 0.982782 0.003855 3 12: 12 0 13: 13 0.108454 1.078072 0.005196 3 14: 14 0.078633 1.056017 0.009165 3 15: 15 0.098571 1.070712 0.007834 3 16: 16 0.044048 1.031003 0.013651 3 17: 17 0.018039 1.012582 0.005471 3 18: 18 -0.088807 0.9403 0.010571 3 19: 19 0.016349 1.011397 0.007113 3 20: 20 0.030977 1.021704 0.016798 3 Testing Bio.Geo on soft_ex_affy.txt GEO Type: SAMPLE GEO Id: body wall rep1 Sample_characteristics: Wild type, third instar larvae, body wal l Sample_data_processing: Affymetrix Microarray Suite version 5.0 Sample_description: Wild type third instar larvae imaginal w ing discs Sample_extract_protocol: Approximately 200 wild-type (Berlin stra in) wandering third-instar larvae were dissected and the wing discs were collect ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted from the tissue lysate using an RNeasy kit (Qiagen). Sample_hyb_protocol: standard Affymetrix procedures Sample_label: biotin Sample_label_protocol: Approximately 8 µg of total RNA was proc essed to produce biotinylated cRNA targets. Sample_molecule: total RNA Sample_organism: Drosophila melanogaster Sample_platform_id: GPL72 Sample_scan_protocol: standard Affymetrix procedures Sample_source_name: body wall Sample_title: body wall replicate 1 Column Header Definitions ABS_CALL: the call in an absolute analysis that in dicates if the transcript was present (P), absent (A), marginal (M), or no call (NC) DETECTION P-VALUE: 'detection p-value', p-value that indica tes the significance level of the detection call ID_REF: VALUE: MAS5-calculated Signal intensity 0: ID_REF VALUE ABS_CALL DETECTION P-VALUE 1: 141200_at 36.6 A 0.818657 2: 141201_at 41.5 A 0.703191 3: 141202_at 607.3 P 0.000944 4: 141203_at 1509.1 P 0.000762 5: 141204_at 837.3 P 0.000613 6: 141205_at 363.2 P 0.003815 7: 141206_at 1193.6 P 0.000491 8: 141207_at 346.6 P 0.001165 9: 141208_at 257.8 P 0.006575 10: 141209_at 337.1 P 0.002607 11: 141210_at 48 A 0.150145 12: 141211_at 130.7 P 0.005504 13: 141212_at 1454.3 P 0.000491 14: 141213_at 21.2 A 0.635055 15: 141214_at 2372.6 P 0.000491 16: 141215_at 452.9 P 0.017732 17: 141216_at 504.1 P 0.006575 18: 141217_at 716.9 P 0.004591 19: 141218_at 3248.8 P 0.000491 20: 141219_at 223.5 P 0.007827 GEO Type: SAMPLE GEO Id: body wall rep2 Sample_characteristics: Wild type, third instar larvae, body wal l Sample_data_processing: Affymetrix Microarray Suite version 5.0 Sample_description: Wild type third instar larvae imaginal w ing discs Sample_extract_protocol: Approximately 200 wild-type (Berlin stra in) wandering third-instar larvae were dissected and the wing discs were collect ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted from the tissue lysate using an RNeasy kit (Qiagen). Sample_hyb_protocol: standard Affymetrix procedures Sample_label: biotin Sample_label_protocol: Approximately 8 µg of total RNA was proc essed to produce biotinylated cRNA targets. Sample_molecule: total RNA Sample_organism: Drosophila melanogaster Sample_platform_id: GPL72 Sample_scan_protocol: standard Affymetrix procedures Sample_source_name: body wall Sample_title: body wall replicate 2 Column Header Definitions ABS_CALL: the call in an absolute analysis that in dicates if the transcript was present (P), absent (A), marginal (M), or no call (NC) DETECTION P-VALUE: 'detection p-value', p-value that indica tes the significance level of the detection call ID_REF: VALUE: MAS5-calculated Signal intensity 0: ID_REF VALUE ABS_CALL DETECTION P-VALUE 1: 141200_at 70.3 A 0.216313 2: 141201_at 38 A 0.635055 3: 141202_at 831.8 P 0.000613 4: 141203_at 2215.5 P 0.000944 5: 141204_at 965.6 P 0.000491 6: 141205_at 383.2 P 0.001432 7: 141206_at 1195 P 0.000491 8: 141207_at 413.7 P 0.000613 9: 141208_at 447.3 P 0.000762 10: 141209_at 294.4 P 0.004591 11: 141210_at 81.7 M 0.054711 12: 141211_at 84.9 P 0.005504 13: 141212_at 1456.4 P 0.000491 14: 141213_at 37 A 0.122747 15: 141214_at 2022 P 0.000491 16: 141215_at 690.9 P 0.004591 17: 141216_at 525.1 P 0.000762 18: 141217_at 643.5 P 0.000613 19: 141218_at 2570.5 P 0.000491 20: 141219_at 265.9 P 0.005504 GEO Type: SAMPLE GEO Id: wing/hinge rep1 Sample_characteristics: Wild type, third instar larvae, wing/hin ge Sample_data_processing: Affymetrix Microarray Suite version 5.0 Sample_description: Wild type third instar larvae imaginal w ing discs Sample_extract_protocol: Approximately 200 wild-type (Berlin stra in) wandering third-instar larvae were dissected and the wing discs were collect ed in a drop of PBS on Sylgard (Dow Corning). Discs were cut between the presump tive hinge and the body wall regions using a 30-gauge syringe needle, and fragme nts were lysed in separate groups in RLT buffer (Qiagen).Total RNA was extracted from the tissue lysate using an RNeasy kit (Qiagen). Sample_hyb_protocol: standard Affymetrix procedures Sample_label: biotin Sample_label_protocol: Approximately 8 µg of total RNA was proc essed to produce biotinylated cRNA targets. Sample_molecule: total RNA Sample_organism: Drosophila melanogaster Sample_platform_id: GPL72 Sample_scan_protocol: standard Affymetrix procedures Sample_source_name: wing/hinge Sample_title: wing/hinge replicate 1 Column Header Definitions ABS_CALL: the call in an absolute analysis that in dicates if the transcript was present (P), absent (A), marginal (M), or no call (NC) DETECTION P-VALUE: 'detection p-value', p-value that indica tes the significance level of the detection call ID_REF: VALUE: MAS5-calculated Signal intensity 0: ID_REF VALUE ABS_CALL DETECTION P-VALUE 1: 141200_at 20.8 A 0.801637 2: 141201_at 85.8 A 0.48748 3: 141202_at 704.8 P 0.000613 4: 141203_at 1036.6 P 0.000944 5: 141204_at 700.3 P 0.000491 6: 141205_at 462.4 P 0.003159 7: 141206_at 1301.9 P 0.000491 8: 141207_at 454.8 P 0.000944 9: 141208_at 438.6 P 0.000944 10: 141209_at 264.4 P 0.004591 11: 141210_at 65.6 A 0.150145 12: 141211_at 72.2 A 0.070073 13: 141212_at 1200 P 0.000491 14: 141213_at 13.7 A 0.635055 15: 141214_at 1944 P 0.000491 16: 141215_at 465.5 P 0.005504 17: 141216_at 538.9 P 0.002607 18: 141217_at 753.9 P 0.003159 19: 141218_at 2942.6 P 0.000491 20: 141219_at 283.9 P 0.010972 Testing Bio.Geo on soft_ex_dual.txt GEO Type: SAMPLE GEO Id: HS-5 cells rep 1 Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5 Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap proximating the expression profile of the majority of human genes was used. Sample_data_processing: After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear tr ansformed to obtain the log and linear values given in the data table. Sample_description: Human bone marrow stromal cells, HS-5 ce lls Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1 8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re moved from the reaction with a Microcon-30 concentrator. Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator. Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce lls/flask. They were cultured for 3 days and harvested by trypsinization followe d by pelleting of the cells. Sample_label_ch1: Cy5 Sample_label_ch2: Cy3 Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_molecule_ch1: total RNA Sample_molecule_ch2: total RNA Sample_organism_ch1: Homo sapiens Sample_organism_ch2: Homo sapiens Sample_platform_id: GPL1001 Sample_scan_protocol: Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit y data were extracted and analyzed with GenePix Pro 3.0 analysis software. Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 ce lls Sample_source_name_ch2: Universal human reference RNA Sample_title: Human bone marrow stromal cells, HS-5 ce lls, replicate 1 Column Header Definitions % > CH1_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of % > CH2_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of the background over the background signal AREA: Number of pixels used to calculate a fea ture's intensity BKD_AREA: Number of pixles used to calculate a fea ture's background CH1_BKD_ Mean: Channel 1 mean background intensity CH1_BKD_ Median: Channel 1 median background intensity CH1_BKD_ SD: Channel 1 background standard deviation CH1_Mean: Channel 1 mean intensity CH1_Mean - CH1_BKD_: Channel 1 mean signal CH1_Median: Channel 1 median intensity CH1_Median - CH1_BKD_: Channel 1 median signal CH1_SD: Channel 1 mean standard deviation CH2_BKD_ Mean: Channel 2 mean background intensity CH2_BKD_ Median: Channel 2 median background intensity CH2_BKD_ SD: Channel 2 background standard deviation CH2_Mean: Channel 2 mean intensity CH2_Mean - CH2_BKD_: Channel 2 mean signal CH2_Median: Channel 2 median intensity CH2_Median - CH2_BKD_: Channel 2 median signal CH2_SD: Channel 2 mean standard deviation Flags: 0 denotes satisfactory features, while < 0 denotes features that did not meet ID_REF: Ratio of Means: Unnormalized, untransformed ratio of mea ns VALUE: Normalized log2 ratio of means defined a s CH1 divided by CH2 0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags 1: 1 17.51 36 38 9 37 38 8 5 45 46 9 46 47 10 0 100000 80 500 -1 -1 1 0 -50 2: 2 -0.10 42 47 19 37 39 11 12 64 65 15 45 47 10 43 0.5 32 176 5 19 10 20 -50 3: 3 -0.42 44 48 18 36 38 8 37 75 75 17 45 46 10 71 0.4 32 176 8 30 12 30 -50 4: 4 17.51 37 40 11 37 39 10 11 42 43 8 43 43 8 2 100000 80 498 0 -1 3 0 -50 5: 5 0.95 147 193 125 37 39 8 98 157 194 109 43 44 9 98 1.033 52 398 110 114 156 151 0 6: 6 0.79 57 62 21 37 39 9 55 69 71 14 44 45 8 76 0.926 52 329 20 25 25 27 -50 7: 7 0.12 45 48 16 37 40 10 28 64 64 14 45 46 9 50 0.579 32 224 8 19 11 19 -50 8: 8 0.68 54 54 17 36 38 9 48 63 64 13 43 44 8 57 0.857 80 510 18 20 18 21 -50 9: 9 -0.10 51 53 16 36 38 9 44 73 77 19 43 44 9 84 0.5 52 406 15 30 17 34 -50 10: 10 0.15 47 50 15 37 39 8 38 65 65 14 43 44 9 63 0.591 52 332 10 22 13 22 -50 11: 11 -1.42 38 40 12 37 39 10 9 58 60 13 45 47 10 31 0.2 32 148 1 13 3 15 -50 12: 12 -0.58 44 47 15 37 39 9 22 70 71 16 43 44 9 70 0.357 80 506 7 27 10 28 -50 13: 13 0.08 63 63 24 36 38 9 63 85 91 21 43 44 9 94 0.563 52 382 27 42 27 48 0 14: 14 -1.05 63 69 23 37 38 9 69 168 167 32 43 45 8 100 0.258 52 382 26 125 32 124 0 15: 15 1.02 439 452 225 37 39 9 98 428 425 198 43 44 8 93 1.086 80 546 402 385 415 382 0 16: 16 2.07 86 91 30 37 39 9 88 66 67 15 43 44 8 70 2.25 80 540 49 23 54 24 0 17: 17 -0.79 40 44 14 36 39 10 11 67 69 15 43 44 9 73 0.308 52 384 4 24 8 26 -50 18: 18 -0.57 50 51 16 37 39 10 37 79 82 22 43 44 9 83 0.359 80 570 13 36 14 39 -50 19: 19 1.90 37 39 10 37 39 10 5 44 44 8 43 44 9 1 2 80 475 0 1 2 1 -50 20: 20 -0.99 42 44 11 37 39 9 9 65 69 16 43 45 9 61 0.269 52 388 5 22 7 26 -50 GEO Type: SAMPLE GEO Id: HS-27a cells Sample_characteristics_ch1: Human bone marrow stromal cells, HS-27a Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap proximating the expression profile of the majority of human genes was used. Sample_data_processing: After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear tr ansformed to obtain the log and linear values given in the data table. Sample_description: Human bone marrow stromal cells, HS-27a cells Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1 8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re moved from the reaction with a Microcon-30 concentrator. Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator. Sample_growth_protocol_ch1: HS-27a cells cultured in RPMI medium 164 0 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization follo wed by pelleting of the cells. Sample_label_ch1: Cy5 Sample_label_ch2: Cy3 Sample_label_protocol_ch1: The cDNA from HS-27a RNA and Human Unive rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2 .7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m l of poly-A for hybridization to the microarray. Sample_label_protocol_ch2: The cDNA from HS-27a RNA and Human Unive rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2 .7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m l of poly-A for hybridization to the microarray. Sample_molecule_ch1: total RNA Sample_molecule_ch2: total RNA Sample_organism_ch1: Homo sapiens Sample_organism_ch2: Homo sapiens Sample_platform_id: GPL1001 Sample_scan_protocol: Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit y data were extracted and analyzed with GenePix Pro 3.0 analysis software. Sample_source_name_ch1: Human bone marrow stromal cells, HS-27a Sample_source_name_ch2: Universal human reference RNA Sample_title: HS-27a cells. Column Header Definitions % > CH1_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of % > CH2_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of the background over the background signal AREA: Number of pixels used to calculate a fea ture's intensity BKD_AREA: Number of pixles used to calculate a fea ture's background CH1_BKD_ Mean: Channel 1 mean background intensity CH1_BKD_ Median: Channel 1 median background intensity CH1_BKD_ SD: Channel 1 background standard deviation CH1_Mean: Channel 1 mean intensity CH1_Mean - CH1_BKD_: Channel 1 mean signal CH1_Median: Channel 1 median intensity CH1_Median - CH1_BKD_: Channel 1 median signal CH1_SD: Channel 1 mean standard deviation CH2_BKD_ Mean: Channel 2 mean background intensity CH2_BKD_ Median: Channel 2 median background intensity CH2_BKD_ SD: Channel 2 background standard deviation CH2_Mean: Channel 2 mean intensity CH2_Mean - CH2_BKD_: Channel 2 mean signal CH2_Median: Channel 2 median intensity CH2_Median - CH2_BKD_: Channel 2 median signal CH2_SD: Channel 2 mean standard deviation Flags: 0 denotes satisfactory features, while < 0 denotes features that did not meet ID_REF: Ratio of Means: Unnormalized, untransformed ratio of mea ns VALUE: Normalized log2 ratio of means defined a s CH1 divided by CH2 0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags 1: 1 17.07 36 40 11 37 40 12 5 39 38 5 38 39 6 1 100000 80 540 -1 1 3 0 -50 2: 2 -0.25 47 51 18 37 39 10 30 60 62 15 39 39 6 71 0.609 52 408 10 21 14 23 -50 3: 3 -0.53 46 49 16 37 40 12 15 62 62 13 38 39 5 86 0.5 52 318 9 24 12 24 -50 4: 4 17.07 36 40 12 36 40 12 10 39 39 6 39 39 6 5 100000 80 489 0 0 4 0 -50 5: 5 1.28 178 251 175 36 41 12 95 116 161 103 39 39 6 95 1.762 80 476 142 77 215 122 0 6: 6 0.83 56 64 31 37 41 18 32 57 60 18 39 39 7 57 1.286 80 514 19 18 27 21 -50 7: 7 0.86 59 63 32 38 40 12 32 55 58 14 39 39 7 57 1.316 52 382 21 16 25 19 -50 8: 8 2.12 124 144 75 37 40 12 95 72 73 15 39 39 6 88 3.147 80 554 87 33 107 34 0 9: 9 -0.24 59 66 26 36 40 12 48 92 87 19 38 39 6 96 0.612 52 400 23 54 30 49 -50 10: 10 0.64 63 63 20 37 40 11 53 58 61 12 38 39 6 75 1.13 80 502 26 20 26 23 -50 11: 11 0.39 50 57 21 38 41 12 31 57 58 11 38 39 7 62 0.95 32 171 12 19 19 20 -50 12: 12 -0.05 57 59 21 38 42 15 25 69 69 13 39 40 6 96 0.7 52 330 19 30 21 30 -50 13: 13 -0.30 76 77 28 37 40 13 67 106 107 20 39 40 6 100 0.588 52 390 39 67 40 68 0 14: 14 0.11 166 170 60 36 39 12 100 210 210 38 39 39 7 100 0.784 52 380 130 171 134 171 0 15: 15 0.92 1356 1345 447 38 42 15 100 1004 993 331 39 40 10 100 1.37 52 380 1318 965 1307 954 0 16: 16 2.92 183 193 62 39 42 12 100 66 67 14 39 39 6 88 5.5 80 476 144 27 154 28 0 17: 17 -0.12 54 58 17 36 39 12 36 70 71 14 38 39 6 93 0.667 80 535 18 32 22 33 -50 18: 18 -1.08 59 62 24 36 39 11 51 109 114 36 38 39 5 100 0.342 80 466 23 71 26 76 -50 19: 19 17.07 36 41 13 38 41 11 11 39 38 5 38 39 5 1 100000 80 485 -2 1 3 0 -50 20: 20 0.05 50 52 20 37 41 24 5 56 58 16 38 39 7 63 0.75 52 371 13 18 15 20 -50 GEO Type: SAMPLE GEO Id: HS-5 cells rep2 Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5 Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap proximating the expression profile of the majority of human genes was used. Sample_data_processing: After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear tr ansformed to obtain the log and linear values given in the data table. Sample_description: Human bone marrow stromal cells, HS-5 ce lls Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1 8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re moved from the reaction with a Microcon-30 concentrator. Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator. Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce lls/flask. They were cultured for 3 days and harvested by trypsinization followe d by pelleting of the cells. Sample_label_ch1: Cy5 Sample_label_ch2: Cy3 Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_molecule_ch1: total RNA Sample_molecule_ch2: total RNA Sample_organism_ch1: Homo sapiens Sample_organism_ch2: Homo sapiens Sample_platform_id: GPL1001 Sample_scan_protocol: Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit y data were extracted and analyzed with GenePix Pro 3.0 analysis software. Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 Sample_source_name_ch2: Universal human reference RNA Sample_title: HS-5 cells, replicate 2 Column Header Definitions % > CH1_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of % > CH2_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of the background over the background signal AREA: Number of pixels used to calculate a fea ture's intensity BKD_AREA: Number of pixles used to calculate a fea ture's background CH1_BKD_ Mean: Channel 1 mean background intensity CH1_BKD_ Median: Channel 1 median background intensity CH1_BKD_ SD: Channel 1 background standard deviation CH1_Mean: Channel 1 mean intensity CH1_Mean - CH1_BKD_: Channel 1 mean signal CH1_Median: Channel 1 median intensity CH1_Median - CH1_BKD_: Channel 1 median signal CH1_SD: Channel 1 mean standard deviation CH2_BKD_ Mean: Channel 2 mean background intensity CH2_BKD_ Median: Channel 2 median background intensity CH2_BKD_ SD: Channel 2 background standard deviation CH2_Mean: Channel 2 mean intensity CH2_Mean - CH2_BKD_: Channel 2 mean signal CH2_Median: Channel 2 median intensity CH2_Median - CH2_BKD_: Channel 2 median signal CH2_SD: Channel 2 mean standard deviation Flags: 0 denotes satisfactory features, while < 0 denotes features that did not meet ID_REF: Ratio of Means: Unnormalized, untransformed ratio of mea ns VALUE: Normalized log2 ratio of means defined a s CH1 divided by CH2 0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags 1: 1 3.74 39 44 16 37 40 13 10 42 42 8 41 42 8 2 7 80 473 2 1 7 1 -50 2: 2 -0.14 46 46 15 37 40 13 10 57 58 14 39 40 7 53 0.474 80 549 9 18 9 19 -50 3: 3 -0.31 47 47 18 36 40 13 16 65 66 18 40 41 7 75 0.423 80 554 11 25 11 26 -50 4: 4 3.74 40 43 12 36 40 12 10 40 40 7 39 40 8 1 7 80 480 4 1 7 1 -50 5: 5 0.60 74 91 55 37 41 14 60 95 108 45 40 41 8 93 0.794 80 532 37 55 54 68 0 6: 6 0.86 60 58 19 38 42 14 33 59 60 14 39 40 8 60 0.952 80 555 22 20 20 21 -50 7: 7 0.67 47 48 14 38 42 14 7 50 52 11 40 41 8 30 0.833 52 392 9 10 10 12 -50 8: 8 0.71 51 56 22 38 41 13 31 62 61 14 40 41 7 66 0.857 80 516 13 22 18 21 -50 9: 9 0.09 49 52 18 37 40 13 21 67 67 18 40 41 7 75 0.556 120 699 12 27 15 27 -50 10: 10 -0.29 45 49 16 40 44 16 9 62 62 14 41 42 10 53 0.429 32 232 5 21 9 21 -50 11: 11 -0.18 42 46 15 40 44 15 10 52 52 11 39 40 8 33 0.462 80 488 2 13 6 13 -50 12: 12 -0.87 45 49 18 39 42 15 10 75 75 15 40 41 8 88 0.286 80 521 6 35 10 35 -50 13: 13 -0.04 64 69 27 37 41 13 51 100 102 23 39 41 8 98 0.508 80 467 27 61 32 63 -50 14: 14 -1.75 58 63 22 37 41 14 38 206 208 43 40 41 8 100 0.155 80 468 21 166 26 168 -50 15: 15 1.32 643 731 413 38 42 15 100 543 569 218 40 41 7 100 1.31 80 537 605 503 693 529 0 16: 16 2.58 162 168 74 37 41 13 98 80 83 22 41 42 8 93 3.119 80 458 125 39 131 42 0 17: 17 -0.75 42 46 15 37 40 12 12 67 69 16 40 41 8 82 0.31 80 470 5 27 9 29 -50 18: 18 -1.39 41 45 16 38 41 13 8 67 75 29 40 41 9 68 0.2 80 555 3 27 7 35 -50 19: 19 0.00 40 42 14 37 40 12 10 39 39 7 40 40 7 2 -5 80 464 3 -1 5 -1 -50 20: 20 -0.65 38 42 15 37 40 14 3 53 55 13 40 41 8 37 0.333 80 549 1 13 5 15 -50 Testing Bio.Geo on soft_ex_family.txt GEO Type: PLATFORM GEO Id: GEO Human 15K v2.0 Platform_coating: unknown Platform_contributor: Jane,Doe Platform_contributor: John,A,Smith Platform_contributor: Hans,van Elton Platform_contributor: John,Smithers Jr Platform_contributor: Jie,D,Chen Platform_description: This set includes 13971 oligonucleotides , mostly 70-mers, designed based upon representative sequences in build 155 of t he human UniGene database. Platform_distribution: non-commercial Platform_manufacture_protocol: as described in GEO Labs manual Platform_manufacturer: GEO Labs Platform_organism: Homo sapiens Platform_pubmed_id: 123456789 Platform_support: glass Platform_technology: spotted oligonucleotide Platform_title: Human 15K long oligo array version 2.0 Platform_web_link: http://geo.best-arrays.org Column Header Definitions COLUMN: Column within array FLAG: Passed validation GB_ACC: GenBank accession number of sequence use d to design oligonucleotide probe LINK_PRE:"http://www.ncbi.nlm.nih.gov/entrez /query.fcgi?cmd GENE_NAME: Descriptive gene name, from UniGene Buil d 155 GENE_SYMBOL: Gene symbol, from UniGene Build 155 ID: LOCUSLINK: LocusLink identifier LINK_PRE:"http:// www.ncbi.nlm.nih.gov/LocusLink/LocRpt.cgi?l PLATE_ID: Plate identifier ROW: Row within array SEQUENCE: Sequence of oligonucleotide probe TIP_ID: Print tip ID UNIGENE: UniGene cluster ID, Build 155 LINK_PRE :"http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG 0: ID GB_ACC GENE_NAME UNIGENE LOCUSLINK GENE_SYMBOL TIP_ID ROW COLUMN PLATE_ID FLAG SEQUENCE 1: 1 NM_012115 CASP8 associated protein 2 122843 9994 CASP8AP2 1 1 1 HK1A1 1 GAGGGCCATCATTTAAAACATTTGCATATTTAGCCGCCAAGTTGGATAAAAATCCAAATCAGGTCTCAGA 2: 2 AF035444 tumor suppressing subtransferable candidate 3 154036 7262 TSSC3 5 1 1 HK1A2 1 CTCATCCAGTCATGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGT 3: 3 AK001420 PEF protein with a long N-terminal hydrophobic domain (peflin) 241531 23578 PEF 1 3 1 HK1A3 1 AATCTGACCAAGCATGAGAGAGATCTGTCTATGGGACCAGTGGCTTGGATTCTGCCACACCCATAAATCC 4: 4 M55150 fumarylacetoacetate hydrolase (fumarylacetoacetase) 73875 2184 FAH 5 3 1 HK1A4 1 TCCTGCCATCATGAGATTTTCTCTGCTCTTCTGGAAACAAAGGGCTCAAGCACCCCTTTCAACCCTGTGA 5: 5 AL121964 1 5 1 HK1A5 1 TCCCTGTGAAACTTTGGTTTCTTTCTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATG 6: 6 NM_012094 peroxiredoxin 5 31731 25824 PRDX5 5 5 1 HK1A6 1 AATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCA 7: 7 AK001917 programmed cell death 6 80019 10016 PDCD6 1 7 1 HK1A7 1 TGTCACGTGGGGACCCAGCTGTACATATGTGGATAAGCTGATTAATGGTTTTGCAACTGTAATAGTAGCT 8: 8 AF135794 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 278582 10000 AKT3 5 7 1 HK1A8 1 CTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGC 9: 9 U43342 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 248037 4773 NFATC2 1 9 1 HK1A9 1 CTACTTGGATGATGTTAATGAAATTATCAGGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAA 10: 10 AF067724 non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) 72050 8382 NME5 5 9 1 HK1A10 1 TTTCATGCTCATGTGTCAGATATGCTTCCCTCAAACCTTGTTACAGCATCATCACATTACCTGTTTGATG 11: 11 M13452 lamin A/C 77886 4000 LMNA 1 11 1 HK1A11 1 GAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAATACACTAGTTGTTTCT 12: 12 AJ242832 calpain 11 225953 11131 CAPN11 5 11 1 HK1A12 1 TGAACAACAAGGTAATGCAGGTCCTGGTGGCCAGGTATGCAGATGATGACCTGATCATAGACTTTGACAG 13: 13 AF041378 cell death-inducing DFFA-like effector a 249129 1149 CIDEA 2 1 1 HK1B1 1 AGGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTACGACATCCG 14: 14 AF014955 programmed cell death 5 166468 9141 PDCD5 6 1 1 HK1B2 1 GAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGG 15: 15 D50857 dedicator of cyto-kinesis 1 82295 1793 DOCK1 2 3 1 HK1B3 1 TGTTCCAGCCGGTGGTGTGACTTCGTTGGTTGAGGTGTGTCTCCAACCTACATCAGACCATGAAGTTCAA 16: 16 AB011414 Kruppel-type zinc finger (C2H2) 142150 10224 ZK1 6 3 1 HK1B4 1 TGATACCTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATGTT 17: 17 AF064019 DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) 133089 1677 DFFB 2 5 1 HK1B5 1 CGGTCTGGAAGGAAACACGCGGATCTGAACAGCAGTAATCCTGGGGGATACGGGGGTTGGGCTAGATTAC 18: 18 U83857 apoptosis inhibitor 5 227913 8539 API5 6 5 1 HK1B6 1 TCACCGTTCCCCTTCCCTTTCGTAAGGCAATAGTGCACAACTTAGGTTATTTTTGCTTCCGAATTTGAAT 19: 19 J05243 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 77196 6709 SPTAN1 2 7 1 HK1B7 1 TAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGACCCAG 20: 20 AB014541 apoptosis-associated tyrosine kinase 128316 9625 AATK 6 7 1 HK1B8 1 ATGTAAAGTTTATTGTTGCTTCGCAGGGGGATTTGTTTTGTGTTTTGTTTGAGGCTTAGAACGCTGGTGC GEO Type: SAMPLE GEO Id: HS-5 cells rep 1 Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5 Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap proximating the expression profile of the majority of human genes was used. Sample_data_processing: After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear tr ansformed to obtain the log and linear values given in the data table. Sample_description: Human bone marrow stromal cells, HS-5 ce lls Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1 8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re moved from the reaction with a Microcon-30 concentrator. Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator. Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce lls/flask. They were cultured for 3 days and harvested by trypsinization followe d by pelleting of the cells. Sample_label_ch1: Cy5 Sample_label_ch2: Cy3 Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_molecule_ch1: total RNA Sample_molecule_ch2: total RNA Sample_organism_ch1: Homo sapiens Sample_organism_ch2: Homo sapiens Sample_platform_id: GEO Human 15K v2.0 Sample_scan_protocol: Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit y data were extracted and analyzed with GenePix Pro 3.0 analysis software. Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 ce lls Sample_source_name_ch2: Universal human reference RNA Sample_title: Human bone marrow stromal cells, HS-5 ce lls, replicate 1 Column Header Definitions % > CH1_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of % > CH2_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of the background over the background signal AREA: Number of pixels used to calculate a fea ture's intensity BKD_AREA: Number of pixles used to calculate a fea ture's background CH1_BKD_ Mean: Channel 1 mean background intensity CH1_BKD_ Median: Channel 1 median background intensity CH1_BKD_ SD: Channel 1 background standard deviation CH1_Mean: Channel 1 mean intensity CH1_Mean - CH1_BKD_: Channel 1 mean signal CH1_Median: Channel 1 median intensity CH1_Median - CH1_BKD_: Channel 1 median signal CH1_SD: Channel 1 mean standard deviation CH2_BKD_ Mean: Channel 2 mean background intensity CH2_BKD_ Median: Channel 2 median background intensity CH2_BKD_ SD: Channel 2 background standard deviation CH2_Mean: Channel 2 mean intensity CH2_Mean - CH2_BKD_: Channel 2 mean signal CH2_Median: Channel 2 median intensity CH2_Median - CH2_BKD_: Channel 2 median signal CH2_SD: Channel 2 mean standard deviation Flags: 0 denotes satisfactory features, while < 0 denotes features that did not meet ID_REF: Ratio of Means: Unnormalized, untransformed ratio of mea ns VALUE: Normalized log2 ratio of means defined a s CH1 divided by CH2 0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags 1: 1 17.51 36 38 9 37 38 8 5 45 46 9 46 47 10 0 100000 80 500 -1 -1 1 0 -50 2: 2 -0.10 42 47 19 37 39 11 12 64 65 15 45 47 10 43 0.5 32 176 5 19 10 20 -50 3: 3 -0.42 44 48 18 36 38 8 37 75 75 17 45 46 10 71 0.4 32 176 8 30 12 30 -50 4: 4 17.51 37 40 11 37 39 10 11 42 43 8 43 43 8 2 100000 80 498 0 -1 3 0 -50 5: 5 0.95 147 193 125 37 39 8 98 157 194 109 43 44 9 98 1.033 52 398 110 114 156 151 0 6: 6 0.79 57 62 21 37 39 9 55 69 71 14 44 45 8 76 0.926 52 329 20 25 25 27 -50 7: 7 0.12 45 48 16 37 40 10 28 64 64 14 45 46 9 50 0.579 32 224 8 19 11 19 -50 8: 8 0.68 54 54 17 36 38 9 48 63 64 13 43 44 8 57 0.857 80 510 18 20 18 21 -50 9: 9 -0.10 51 53 16 36 38 9 44 73 77 19 43 44 9 84 0.5 52 406 15 30 17 34 -50 10: 10 0.15 47 50 15 37 39 8 38 65 65 14 43 44 9 63 0.591 52 332 10 22 13 22 -50 11: 11 -1.42 38 40 12 37 39 10 9 58 60 13 45 47 10 31 0.2 32 148 1 13 3 15 -50 12: 12 -0.58 44 47 15 37 39 9 22 70 71 16 43 44 9 70 0.357 80 506 7 27 10 28 -50 13: 13 0.08 63 63 24 36 38 9 63 85 91 21 43 44 9 94 0.563 52 382 27 42 27 48 0 14: 14 -1.05 63 69 23 37 38 9 69 168 167 32 43 45 8 100 0.258 52 382 26 125 32 124 0 15: 15 1.02 439 452 225 37 39 9 98 428 425 198 43 44 8 93 1.086 80 546 402 385 415 382 0 16: 16 2.07 86 91 30 37 39 9 88 66 67 15 43 44 8 70 2.25 80 540 49 23 54 24 0 17: 17 -0.79 40 44 14 36 39 10 11 67 69 15 43 44 9 73 0.308 52 384 4 24 8 26 -50 18: 18 -0.57 50 51 16 37 39 10 37 79 82 22 43 44 9 83 0.359 80 570 13 36 14 39 -50 19: 19 1.90 37 39 10 37 39 10 5 44 44 8 43 44 9 1 2 80 475 0 1 2 1 -50 20: 20 -0.99 42 44 11 37 39 9 9 65 69 16 43 45 9 61 0.269 52 388 5 22 7 26 -50 GEO Type: SAMPLE GEO Id: HS-27a cells Sample_characteristics_ch1: Human bone marrow stromal cells, HS-27a Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap proximating the expression profile of the majority of human genes was used. Sample_data_processing: After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear tr ansformed to obtain the log and linear values given in the data table. Sample_description: Human bone marrow stromal cells, HS-27a cells Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1 8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re moved from the reaction with a Microcon-30 concentrator. Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator. Sample_growth_protocol_ch1: HS-27a cells cultured in RPMI medium 164 0 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 cells/flask. They were cultured for 3 days and harvested by trypsinization follo wed by pelleting of the cells. Sample_label_ch1: Cy5 Sample_label_ch2: Cy3 Sample_label_protocol_ch1: The cDNA from HS-27a RNA and Human Unive rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2 .7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m l of poly-A for hybridization to the microarray. Sample_label_protocol_ch2: The cDNA from HS-27a RNA and Human Unive rsal RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, respectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2 .7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified wi th a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/m l of poly-A for hybridization to the microarray. Sample_molecule_ch1: total RNA Sample_molecule_ch2: total RNA Sample_organism_ch1: Homo sapiens Sample_organism_ch2: Homo sapiens Sample_platform_id: GEO Human 15K v2.0 Sample_scan_protocol: Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit y data were extracted and analyzed with GenePix Pro 3.0 analysis software. Sample_source_name_ch1: Human bone marrow stromal cells, HS-27a Sample_source_name_ch2: Universal human reference RNA Sample_title: HS-27a cells. Column Header Definitions % > CH1_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of % > CH2_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of the background over the background signal AREA: Number of pixels used to calculate a fea ture's intensity BKD_AREA: Number of pixles used to calculate a fea ture's background CH1_BKD_ Mean: Channel 1 mean background intensity CH1_BKD_ Median: Channel 1 median background intensity CH1_BKD_ SD: Channel 1 background standard deviation CH1_Mean: Channel 1 mean intensity CH1_Mean - CH1_BKD_: Channel 1 mean signal CH1_Median: Channel 1 median intensity CH1_Median - CH1_BKD_: Channel 1 median signal CH1_SD: Channel 1 mean standard deviation CH2_BKD_ Mean: Channel 2 mean background intensity CH2_BKD_ Median: Channel 2 median background intensity CH2_BKD_ SD: Channel 2 background standard deviation CH2_Mean: Channel 2 mean intensity CH2_Mean - CH2_BKD_: Channel 2 mean signal CH2_Median: Channel 2 median intensity CH2_Median - CH2_BKD_: Channel 2 median signal CH2_SD: Channel 2 mean standard deviation Flags: 0 denotes satisfactory features, while < 0 denotes features that did not meet ID_REF: Ratio of Means: Unnormalized, untransformed ratio of mea ns VALUE: Normalized log2 ratio of means defined a s CH1 divided by CH2 0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags 1: 1 17.07 36 40 11 37 40 12 5 39 38 5 38 39 6 1 100000 80 540 -1 1 3 0 -50 2: 2 -0.25 47 51 18 37 39 10 30 60 62 15 39 39 6 71 0.609 52 408 10 21 14 23 -50 3: 3 -0.53 46 49 16 37 40 12 15 62 62 13 38 39 5 86 0.5 52 318 9 24 12 24 -50 4: 4 17.07 36 40 12 36 40 12 10 39 39 6 39 39 6 5 100000 80 489 0 0 4 0 -50 5: 5 1.28 178 251 175 36 41 12 95 116 161 103 39 39 6 95 1.762 80 476 142 77 215 122 0 6: 6 0.83 56 64 31 37 41 18 32 57 60 18 39 39 7 57 1.286 80 514 19 18 27 21 -50 7: 7 0.86 59 63 32 38 40 12 32 55 58 14 39 39 7 57 1.316 52 382 21 16 25 19 -50 8: 8 2.12 124 144 75 37 40 12 95 72 73 15 39 39 6 88 3.147 80 554 87 33 107 34 0 9: 9 -0.24 59 66 26 36 40 12 48 92 87 19 38 39 6 96 0.612 52 400 23 54 30 49 -50 10: 10 0.64 63 63 20 37 40 11 53 58 61 12 38 39 6 75 1.13 80 502 26 20 26 23 -50 11: 11 0.39 50 57 21 38 41 12 31 57 58 11 38 39 7 62 0.95 32 171 12 19 19 20 -50 12: 12 -0.05 57 59 21 38 42 15 25 69 69 13 39 40 6 96 0.7 52 330 19 30 21 30 -50 13: 13 -0.30 76 77 28 37 40 13 67 106 107 20 39 40 6 100 0.588 52 390 39 67 40 68 0 14: 14 0.11 166 170 60 36 39 12 100 210 210 38 39 39 7 100 0.784 52 380 130 171 134 171 0 15: 15 0.92 1356 1345 447 38 42 15 100 1004 993 331 39 40 10 100 1.37 52 380 1318 965 1307 954 0 16: 16 2.92 183 193 62 39 42 12 100 66 67 14 39 39 6 88 5.5 80 476 144 27 154 28 0 17: 17 -0.12 54 58 17 36 39 12 36 70 71 14 38 39 6 93 0.667 80 535 18 32 22 33 -50 18: 18 -1.08 59 62 24 36 39 11 51 109 114 36 38 39 5 100 0.342 80 466 23 71 26 76 -50 19: 19 17.07 36 41 13 38 41 11 11 39 38 5 38 39 5 1 100000 80 485 -2 1 3 0 -50 20: 20 0.05 50 52 20 37 41 24 5 56 58 16 38 39 7 63 0.75 52 371 13 18 15 20 -50 GEO Type: SAMPLE GEO Id: HS-5 cells rep2 Sample_characteristics_ch1: Human bone marrow stromal cells, HS-5 Sample_characteristics_ch2: As a control RNA, Human Universal RNA (S tratagene, La Jolla, CA) which is a mixture of RNA from 10 control cell lines ap proximating the expression profile of the majority of human genes was used. Sample_data_processing: After background correction and removal of flagged values, log base 2 expression ratios were mean centered and linear tr ansformed to obtain the log and linear values given in the data table. Sample_description: Human bone marrow stromal cells, HS-5 ce lls Sample_extract_protocol_ch1: RNA isolation was accomplished with Qiag en RNeasy Mini Kit reagents. The RNA (30 µg) was annealed with 5 µg oligo dT12-1 8, and reverse-transcribed into cDNA with Superscript II reverse transcriptase f or 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dATP, 0.3 mM d TTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was re moved from the reaction with a Microcon-30 concentrator. Sample_extract_protocol_ch2: The RNA (30 µg) was annealed with 5 µg o ligo dT12-18, and reverse-transcribed into cDNA with Superscript II reverse tran scriptase for 2h at 42°C in the presence of 0.5 mM dGTP, 0.5 mM dCTP, 0.5 mM dAT P, 0.3 mM dTTP, 0.2 mM amino-allyl dUTP. After hydrolysis of RNA in 0.2 M NaOH, Tris was removed from the reaction with a Microcon-30 concentrator. Sample_growth_protocol_ch1: HS-5 cells cultured in RPMI medium 1640 containing 10% fetal calf serum. Cells were plated in T75 flasks at 3,000,000 ce lls/flask. They were cultured for 3 days and harvested by trypsinization followe d by pelleting of the cells. Sample_label_ch1: Cy5 Sample_label_ch2: Cy3 Sample_label_protocol_ch1: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_label_protocol_ch2: The cDNA from HS-5 RNA and Human Univers al RNA was covalently coupled separately with Cy5 and Cy3 monoreactive fluors, r espectively, in 50 mM sodium bicarbonate, pH 9.0, followed by quenching with 2.7 M hydroxylamine. The Cy5 and Cy3 labelled cDNAs were combined and purified with a QIAquick PCR purification kit and suspended in 36 µl of 3X SSC and 0.8 mg/ml of poly-A for hybridization to the microarray. Sample_molecule_ch1: total RNA Sample_molecule_ch2: total RNA Sample_organism_ch1: Homo sapiens Sample_organism_ch2: Homo sapiens Sample_platform_id: GEO Human 15K v2.0 Sample_scan_protocol: Fluorescent array images were collected for both Cy3 and Cy5 with a GenePix 4000A fluorescent scanner and image intensit y data were extracted and analyzed with GenePix Pro 3.0 analysis software. Sample_source_name_ch1: Human bone marrow stromal cells, HS-5 Sample_source_name_ch2: Universal human reference RNA Sample_title: HS-5 cells, replicate 2 Column Header Definitions % > CH1_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of % > CH2_BKD_+2SD: Percent of feature pixels that were grea ter than two standard deviations of the background over the background signal AREA: Number of pixels used to calculate a fea ture's intensity BKD_AREA: Number of pixles used to calculate a fea ture's background CH1_BKD_ Mean: Channel 1 mean background intensity CH1_BKD_ Median: Channel 1 median background intensity CH1_BKD_ SD: Channel 1 background standard deviation CH1_Mean: Channel 1 mean intensity CH1_Mean - CH1_BKD_: Channel 1 mean signal CH1_Median: Channel 1 median intensity CH1_Median - CH1_BKD_: Channel 1 median signal CH1_SD: Channel 1 mean standard deviation CH2_BKD_ Mean: Channel 2 mean background intensity CH2_BKD_ Median: Channel 2 median background intensity CH2_BKD_ SD: Channel 2 background standard deviation CH2_Mean: Channel 2 mean intensity CH2_Mean - CH2_BKD_: Channel 2 mean signal CH2_Median: Channel 2 median intensity CH2_Median - CH2_BKD_: Channel 2 median signal CH2_SD: Channel 2 mean standard deviation Flags: 0 denotes satisfactory features, while < 0 denotes features that did not meet ID_REF: Ratio of Means: Unnormalized, untransformed ratio of mea ns VALUE: Normalized log2 ratio of means defined a s CH1 divided by CH2 0: ID_REF VALUE CH1_Median CH1_Mean CH1_SD CH1_BKD_ Median CH1_BKD_ Mean CH1_BKD_ SD % > CH1_BKD_+2SD CH2_Median CH2_Mean CH2_SD CH2_BKD_ Median CH2_BKD_ Mean CH2_BKD_ SD % > CH2_BKD_+2SD Ratio of Means AREA BKD_AREA CH1_Median - CH1_BKD_ CH2_Median - CH2_BKD_ CH1_Mean - CH1_BKD_ CH2_Mean - CH2_BKD_ Flags 1: 1 3.74 39 44 16 37 40 13 10 42 42 8 41 42 8 2 7 80 473 2 1 7 1 -50 2: 2 -0.14 46 46 15 37 40 13 10 57 58 14 39 40 7 53 0.474 80 549 9 18 9 19 -50 3: 3 -0.31 47 47 18 36 40 13 16 65 66 18 40 41 7 75 0.423 80 554 11 25 11 26 -50 4: 4 3.74 40 43 12 36 40 12 10 40 40 7 39 40 8 1 7 80 480 4 1 7 1 -50 5: 5 0.60 74 91 55 37 41 14 60 95 108 45 40 41 8 93 0.794 80 532 37 55 54 68 0 6: 6 0.86 60 58 19 38 42 14 33 59 60 14 39 40 8 60 0.952 80 555 22 20 20 21 -50 7: 7 0.67 47 48 14 38 42 14 7 50 52 11 40 41 8 30 0.833 52 392 9 10 10 12 -50 8: 8 0.71 51 56 22 38 41 13 31 62 61 14 40 41 7 66 0.857 80 516 13 22 18 21 -50 9: 9 0.09 49 52 18 37 40 13 21 67 67 18 40 41 7 75 0.556 120 699 12 27 15 27 -50 10: 10 -0.29 45 49 16 40 44 16 9 62 62 14 41 42 10 53 0.429 32 232 5 21 9 21 -50 11: 11 -0.18 42 46 15 40 44 15 10 52 52 11 39 40 8 33 0.462 80 488 2 13 6 13 -50 12: 12 -0.87 45 49 18 39 42 15 10 75 75 15 40 41 8 88 0.286 80 521 6 35 10 35 -50 13: 13 -0.04 64 69 27 37 41 13 51 100 102 23 39 41 8 98 0.508 80 467 27 61 32 63 -50 14: 14 -1.75 58 63 22 37 41 14 38 206 208 43 40 41 8 100 0.155 80 468 21 166 26 168 -50 15: 15 1.32 643 731 413 38 42 15 100 543 569 218 40 41 7 100 1.31 80 537 605 503 693 529 0 16: 16 2.58 162 168 74 37 41 13 98 80 83 22 41 42 8 93 3.119 80 458 125 39 131 42 0 17: 17 -0.75 42 46 15 37 40 12 12 67 69 16 40 41 8 82 0.31 80 470 5 27 9 29 -50 18: 18 -1.39 41 45 16 38 41 13 8 67 75 29 40 41 9 68 0.2 80 555 3 27 7 35 -50 19: 19 0.00 40 42 14 37 40 12 10 39 39 7 40 40 7 2 -5 80 464 3 -1 5 -1 -50 20: 20 -0.65 38 42 15 37 40 14 3 53 55 13 40 41 8 37 0.333 80 549 1 13 5 15 -50 GEO Type: SERIES GEO Id: Bone_marrow_stromal_cells Series_contributor: Jane,,Doe Series_contributor: John,A,Smith Series_overall_design: We analyzed 2 arrays for HS-5 cell line and 1 array for HS-27a cell line Series_pubmed_id: 123456789 Series_sample_id: HS-5 cells rep1 Series_sample_id: HS-27a cells Series_sample_id: HS-5 cells rep2 Series_summary: Two human stromal cell lines, HS-5 and H S-27a, represent functionally distinct components of the bone marrow microenviro nment.1,2 HS-27a supports cobblestone area formation by early hematopoietic prog enitors, whereas HS-5 secretes multiple cytokines that support the proliferation of committed progenitors. These cell lines have been distributed to research gr oups worldwide for use as a tool to understand interactions between hematopoieti c cells and their microenvironment. We have used DNA microarray technology to ch aracterize and compare the expression of over 17 000 genes in these cell lines. Gene expression differences in cytokines/chemokines, G-protein signaling molecul es, and multiple extracellular matrix proteins add to the known protein and func tional characterization of the lines, leading to new insight into the difference s in their support function for hematopoietic progenitors. Series_title: Profiling of the functionally distinct h uman bone marrow stromal cell lines HS-5 and HS-27a. Series_type: other Series_web_link: http://geo.best-arrays.org Column Header Definitions Testing Bio.Geo on soft_ex_platform.txt GEO Type: PLATFORM GEO Id: GEO Human 14K v 1.0 Platform_coating: unknown Platform_contributor: Jane,,Doe Platform_contributor: John,A,Smith Platform_contributor: Hans,van Elton Platform_contributor: John,Smithers Jr Platform_contributor: Jie,D,Chen Platform_description: This set includes 13971 oligonucleotides , mostly 70-mers, designed based upon representative sequences in build 155 of t he human UniGene database. Platform_distribution: non-commercial Platform_manufacture_protocol: as described in GEO Labs manual Platform_manufacturer: GEO Labs Platform_organism: Homo sapiens Platform_pubmed_id: 123456789 Platform_support: glass Platform_technology: spotted oligonucleotide Platform_title: Human 14K long oligo array Platform_web_link: http://geo.best-arrays.org Column Header Definitions COLUMN: Column within array FLAG: Passed validation GB_ACC: GenBank accession number of sequence use d to design oligonucleotide probe GENE_NAME: Descriptive gene name, from UniGene Buil d 155 GENE_SYMBOL: Gene symbol, from UniGene Build 155 ID: LOCUSLINK: LocusLink identifier PLATE_ID: Plate identifier ROW: Row within array SEQUENCE: Sequence of oligonucleotide probe TIP_ID: Print tip ID UNIGENE: UniGene cluster ID, Build 155 0: ID GB_ACC GENE_NAME UNIGENE LOCUSLINK GENE_SYMBOL TIP_ID ROW COLUMN PLATE_ID FLAG SEQUENCE 1: 1 NM_012115 CASP8 associated protein 2 122843 9994 CASP8AP2 1 1 1 HK1A1 1 GAGGGCCATCATTTAAAACATTTGCATATTTAGCCGCCAAGTTGGATAAAAATCCAAATCAGGTCTCAGA 2: 2 AF035444 tumor suppressing subtransferable candidate 3 154036 7262 TSSC3 5 1 1 HK1A2 1 CTCATCCAGTCATGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGT 3: 3 AK001420 PEF protein with a long N-terminal hydrophobic domain (peflin) 241531 23578 PEF 1 3 1 HK1A3 1 AATCTGACCAAGCATGAGAGAGATCTGTCTATGGGACCAGTGGCTTGGATTCTGCCACACCCATAAATCC 4: 4 M55150 fumarylacetoacetate hydrolase (fumarylacetoacetase) 73875 2184 FAH 5 3 1 HK1A4 1 TCCTGCCATCATGAGATTTTCTCTGCTCTTCTGGAAACAAAGGGCTCAAGCACCCCTTTCAACCCTGTGA 5: 5 AL121964 1 5 1 HK1A5 1 TCCCTGTGAAACTTTGGTTTCTTTCTATAAATGTGTGTGGTTTTCAGCGCTCAACTCCTGTCTTCAAATG 6: 6 NM_012094 peroxiredoxin 5 31731 25824 PRDX5 5 5 1 HK1A6 1 AATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCA 7: 7 AK001917 programmed cell death 6 80019 10016 PDCD6 1 7 1 HK1A7 1 TGTCACGTGGGGACCCAGCTGTACATATGTGGATAAGCTGATTAATGGTTTTGCAACTGTAATAGTAGCT 8: 8 AF135794 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 278582 10000 AKT3 5 7 1 HK1A8 1 CTTTGGGAGAAGAGATGCTGCCATTTAACCCCTTGGTACTGAAAATGAGAAAATCCCCAACTATGCATGC 9: 9 U43342 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 248037 4773 NFATC2 1 9 1 HK1A9 1 CTACTTGGATGATGTTAATGAAATTATCAGGAAGGAGTTTTCAGGACCTCCTGCCAGAAATCAGACGTAA 10: 10 AF067724 non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) 72050 8382 NME5 5 9 1 HK1A10 1 TTTCATGCTCATGTGTCAGATATGCTTCCCTCAAACCTTGTTACAGCATCATCACATTACCTGTTTGATG 11: 11 M13452 lamin A/C 77886 4000 LMNA 1 11 1 HK1A11 1 GAGCCCTTGCCTCCCCATTTCCCATCTGCACCCCTTCTCTCCTCCCCAAATCAATACACTAGTTGTTTCT 12: 12 AJ242832 calpain 11 225953 11131 CAPN11 5 11 1 HK1A12 1 TGAACAACAAGGTAATGCAGGTCCTGGTGGCCAGGTATGCAGATGATGACCTGATCATAGACTTTGACAG 13: 13 AF041378 cell death-inducing DFFA-like effector a 249129 1149 CIDEA 2 1 1 HK1B1 1 AGGACTTCATCGGCTGCCTTAACGTGAAGGCCACCATGTATGAGATGTACTCCGTGTCCTACGACATCCG 14: 14 AF014955 programmed cell death 5 166468 9141 PDCD5 6 1 1 HK1B2 1 GAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGG 15: 15 D50857 dedicator of cyto-kinesis 1 82295 1793 DOCK1 2 3 1 HK1B3 1 TGTTCCAGCCGGTGGTGTGACTTCGTTGGTTGAGGTGTGTCTCCAACCTACATCAGACCATGAAGTTCAA 16: 16 AB011414 Kruppel-type zinc finger (C2H2) 142150 10224 ZK1 6 3 1 HK1B4 1 TGATACCTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATGTT 17: 17 AF064019 DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) 133089 1677 DFFB 2 5 1 HK1B5 1 CGGTCTGGAAGGAAACACGCGGATCTGAACAGCAGTAATCCTGGGGGATACGGGGGTTGGGCTAGATTAC 18: 18 U83857 apoptosis inhibitor 5 227913 8539 API5 6 5 1 HK1B6 1 TCACCGTTCCCCTTCCCTTTCGTAAGGCAATAGTGCACAACTTAGGTTATTTTTGCTTCCGAATTTGAAT 19: 19 J05243 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 77196 6709 SPTAN1 2 7 1 HK1B7 1 TAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGACCCAG 20: 20 AB014541 apoptosis-associated tyrosine kinase 128316 9625 AATK 6 7 1 HK1B8 1 ATGTAAAGTTTATTGTTGCTTCGCAGGGGGATTTGTTTTGTGTTTTGTTTGAGGCTTAGAACGCTGGTGC Testing Bio.Geo on soft_ex_series.txt GEO Type: SERIES GEO Id: Bone_marrow_stromal_cells Series_contributor: Jane,Doe Series_contributor: John,A,Smith Series_contributor: Hans,van Elton Series_contributor: John,Smithers Jr Series_contributor: Jie,D,Chen Series_overall_design: We analyzed 2 arrays for HS-5 cell line and 2 arrays for HS-27a cell line Series_pubmed_id: 123456789 Series_sample_id: GSM10001 Series_sample_id: GSM10002 Series_sample_id: GSM10003 Series_sample_id: GSM10004 Series_summary: Two human stromal cell lines, HS-5 and H S-27a, represent functionally distinct components of the bone marrow microenviro nment.1,2 HS-27a supports cobblestone area formation by early hematopoietic prog enitors, whereas HS-5 secretes multiple cytokines that support the proliferation of committed progenitors. These cell lines have been distributed to research gr oups worldwide for use as a tool to understand interactions between hematopoieti c cells and their microenvironment. We have used DNA microarray technology to ch aracterize and compare the expression of over 17 000 genes in these cell lines. Gene expression differences in cytokines/chemokines, G-protein signaling molecul es, and multiple extracellular matrix proteins add to the known protein and func tional characterization of the lines, leading to new insight into the difference s in their support function for hematopoietic progenitors. Series_title: Profiling of the functionally distinct h uman bone marrow stromal cell lines HS-5 and HS-27a. Series_type: Cell Line Comparison Series_variable_1: cell line Series_variable_2: cell line Series_variable_description_1: HS-5 Series_variable_description_2: HS-27a Series_variable_sample_list_1: GSM10001, GSM10002 Series_variable_sample_list_2: GSM10003, GSM10004 Column Header Definitions